Mutagenetix > Incidental Mutation

Incidental Mutation 'R2116:Kcnd2'

233138

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

040120-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R2116 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21216432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 45 (L45Q)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably damaging
Transcript: ENSMUST00000081542
AA Change: L45Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: L45Q

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,164,860	V401E	probably damaging	Het
4833427G06Rik	A	G	9: 51,101,084	S79P	possibly damaging	Het
Adamts20	A	G	15: 94,355,362	C377R	probably damaging	Het
Adgrv1	T	C	13: 81,529,013	K1180E	probably benign	Het
Ankle1	A	G	8: 71,407,918	T340A	probably benign	Het
Armc2	A	T	10: 41,963,667	L434Q	probably damaging	Het
Ash1l	C	T	3: 88,983,264	L817F	probably benign	Het
Atm	C	T	9: 53,500,969	E960K	probably benign	Het
Bend5	G	T	4: 111,415,239	R22L	probably benign	Het
Cacng6	C	T	7: 3,430,504	T133I	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Cmah	G	A	13: 24,428,897	D26N	probably benign	Het
Cnot1	A	C	8: 95,726,153	D2098E	probably damaging	Het
Cnot10	A	C	9: 114,626,436	S207R	probably damaging	Het
Col14a1	A	G	15: 55,407,764	T638A	unknown	Het
Coro1a	T	C	7: 126,702,022	E102G	probably damaging	Het
Ddx27	A	C	2: 167,027,764	D373A	probably benign	Het
Defb38	A	T	8: 19,023,467	Y63*	probably null	Het
Dhx37	A	G	5: 125,421,102	V681A	probably damaging	Het
Dmxl1	T	A	18: 49,878,817	L1347H	probably damaging	Het
Dnmt3l	C	A	10: 78,063,296	L110I	probably damaging	Het
Gcn1l1	A	T	5: 115,598,825	M1276L	probably benign	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm12790	G	A	4: 101,967,651	T140I	possibly damaging	Het
Golga3	A	T	5: 110,187,395	M192L	probably damaging	Het
H2-T22	A	T	17: 36,039,057		probably null	Het
Hectd2	C	A	19: 36,614,424	T675K	probably damaging	Het
Hinfp	T	C	9: 44,299,615	N116S	probably damaging	Het
Hs6st3	T	A	14: 119,869,287	L369Q	probably damaging	Het
Ift74	A	G	4: 94,627,259	T138A	probably benign	Het
Ipo7	T	A	7: 110,051,118	Y792N	probably damaging	Het
Jak1	A	T	4: 101,179,675	I256N	probably damaging	Het
Klhl3	A	T	13: 58,018,991	V342E	probably damaging	Het
Krt28	A	C	11: 99,365,117	S439A	probably benign	Het
L3mbtl1	T	A	2: 162,960,070		probably null	Het
Lrch1	G	A	14: 74,785,531	P634L	probably damaging	Het
Lrp1	C	T	10: 127,576,493	W1314*	probably null	Het
Lrwd1	T	A	5: 136,130,478	Y431F	probably damaging	Het
Lyst	A	G	13: 13,635,701	E652G	probably damaging	Het
Mageb3	A	G	2: 121,954,552	V223A	probably damaging	Het
Map1b	G	T	13: 99,430,644	S1856R	unknown	Het
Mecom	T	A	3: 29,965,458	Q759L	probably damaging	Het
Mfsd6	T	A	1: 52,660,975	R671S	probably benign	Het
Mllt10	A	G	2: 18,162,569	N435S	probably benign	Het
Mta2	T	C	19: 8,943,516	I27T	probably damaging	Het
Ndufab1	A	G	7: 122,101,764	L20P	probably benign	Het
Nfatc2ip	T	A	7: 126,385,108	Y371F	probably damaging	Het
Nhlrc1	A	C	13: 47,014,185	S199A	probably benign	Het
Nipa1	G	T	7: 55,985,525	N113K	possibly damaging	Het
Nlgn1	T	A	3: 26,133,265	N157I	probably damaging	Het
Nlrp1a	T	A	11: 71,114,500	K630*	probably null	Het
Nmi	T	C	2: 51,948,707	T272A	probably benign	Het
Nr1i3	T	A	1: 171,218,594	L181Q	probably damaging	Het
Nrxn1	A	T	17: 90,704,277	I308K	probably damaging	Het
Olfr1043	A	T	2: 86,162,729	Y73*	probably null	Het
Olfr150	T	A	9: 39,737,304	M163K	probably damaging	Het
Olfr294	T	C	7: 86,616,078	D189G	probably benign	Het
Olfr625-ps1	T	C	7: 103,683,312	I188T	probably damaging	Het
Osgin2	G	A	4: 16,008,648	T51M	probably damaging	Het
Pkd1l2	T	A	8: 117,030,722	T1526S	possibly damaging	Het
Pkhd1l1	G	T	15: 44,569,482	A3378S	probably damaging	Het
Plg	A	T	17: 12,384,477	D90V	probably damaging	Het
Plppr3	A	T	10: 79,865,738	D423E	probably benign	Het
Prpf8	T	C	11: 75,487,721	V66A	possibly damaging	Het
Psg19	A	T	7: 18,794,255	Y188N	probably damaging	Het
Ptgs1	C	A	2: 36,237,696	S89*	probably null	Het
Ptx3	T	A	3: 66,224,766	I236N	probably damaging	Het
Pygm	A	G	19: 6,386,408	N100S	probably damaging	Het
Reps1	A	G	10: 18,124,920	E760G	probably damaging	Het
Rgs7	T	A	1: 175,091,073	N235I	probably damaging	Het
Rgsl1	T	A	1: 153,817,549	M629L	probably benign	Het
Rrh	T	C	3: 129,810,687	I288M	probably damaging	Het
Sctr	A	T	1: 120,031,582	D70V	probably damaging	Het
Sec11c	A	T	18: 65,800,649	T9S	probably benign	Het
Spty2d1	C	T	7: 46,996,185	G570D	probably damaging	Het
Stx1b	T	C	7: 127,810,905	E153G	probably damaging	Het
Synm	G	A	7: 67,733,595	R1440W	probably benign	Het
Tcof1	T	C	18: 60,832,785	E415G	possibly damaging	Het
Tgfb1i1	G	A	7: 128,252,805	R353H	probably damaging	Het
Thbs3	T	C	3: 89,219,392	F271S	probably damaging	Het
Tlr5	T	C	1: 182,975,629	W833R	probably damaging	Het
Tmem132b	A	G	5: 125,622,551	E92G	probably damaging	Het
Tmem221	T	C	8: 71,557,828	Y133C	probably damaging	Het
Tmem229b-ps	A	G	10: 53,475,456		noncoding transcript	Het
Tnxb	T	C	17: 34,672,227	C515R	probably damaging	Het
Trp53rka	T	A	2: 165,491,495	N158I	probably damaging	Het
Tsta3	A	G	15: 75,926,142	F223S	probably damaging	Het
Usp20	T	A	2: 31,016,305	C562S	probably damaging	Het
Usp31	C	T	7: 121,648,696	V1175M	probably benign	Het
Veph1	G	T	3: 66,057,189	N806K	probably benign	Het
Vmn1r223	G	T	13: 23,249,662	C142F	probably damaging	Het
Vmn2r80	A	T	10: 79,194,724	S795C	probably benign	Het
Wdr41	A	G	13: 95,015,029		probably null	Het
Zfp617	A	T	8: 71,932,165	H113L	probably benign	Het
Zfp715	T	A	7: 43,297,946	R863S	possibly damaging	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCTGAGGTGAAGAAGTG -3'
(R):5'- AAGCCGAGATGCACTCATG -3'

Sequencing Primer
(F):5'- GGGGCACTTTCTTACTTTCATTG -3'
(R):5'- ATAGTGAAGCTTCCCCGTGC -3'

Posted On

2014-09-18