Mutagenetix > Incidental Mutations

Incidental Mutation 'R2116:Cnot1'

233163

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040120-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2116 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 95726153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2098 (D2098E)

Ref Sequence

ENSEMBL: ENSMUSP00000148807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: D2100E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: D2100E

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: D2105E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: D2105E

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: D2098E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212302

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212369

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

probably benign
Transcript: ENSMUST00000213006

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,164,860	V401E	probably damaging	Het
4833427G06Rik	A	G	9: 51,101,084	S79P	possibly damaging	Het
Adamts20	A	G	15: 94,355,362	C377R	probably damaging	Het
Adgrv1	T	C	13: 81,529,013	K1180E	probably benign	Het
Ankle1	A	G	8: 71,407,918	T340A	probably benign	Het
Armc2	A	T	10: 41,963,667	L434Q	probably damaging	Het
Ash1l	C	T	3: 88,983,264	L817F	probably benign	Het
Atm	C	T	9: 53,500,969	E960K	probably benign	Het
Bend5	G	T	4: 111,415,239	R22L	probably benign	Het
Cacng6	C	T	7: 3,430,504	T133I	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Ciz1	T	C	2: 32,367,465	L174P	probably damaging	Het
Cmah	G	A	13: 24,428,897	D26N	probably benign	Het
Cnot10	A	C	9: 114,626,436	S207R	probably damaging	Het
Col14a1	A	G	15: 55,407,764	T638A	unknown	Het
Coro1a	T	C	7: 126,702,022	E102G	probably damaging	Het
Ddx27	A	C	2: 167,027,764	D373A	probably benign	Het
Defb38	A	T	8: 19,023,467	Y63*	probably null	Het
Dhx37	A	G	5: 125,421,102	V681A	probably damaging	Het
Dmxl1	T	A	18: 49,878,817	L1347H	probably damaging	Het
Dnmt3l	C	A	10: 78,063,296	L110I	probably damaging	Het
Gcn1l1	A	T	5: 115,598,825	M1276L	probably benign	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gm12790	G	A	4: 101,967,651	T140I	possibly damaging	Het
Golga3	A	T	5: 110,187,395	M192L	probably damaging	Het
H2-T22	A	T	17: 36,039,057		probably null	Het
Hectd2	C	A	19: 36,614,424	T675K	probably damaging	Het
Hinfp	T	C	9: 44,299,615	N116S	probably damaging	Het
Hs6st3	T	A	14: 119,869,287	L369Q	probably damaging	Het
Ift74	A	G	4: 94,627,259	T138A	probably benign	Het
Ipo7	T	A	7: 110,051,118	Y792N	probably damaging	Het
Jak1	A	T	4: 101,179,675	I256N	probably damaging	Het
Kcnd2	T	A	6: 21,216,432	L45Q	probably damaging	Het
Klhl3	A	T	13: 58,018,991	V342E	probably damaging	Het
Krt28	A	C	11: 99,365,117	S439A	probably benign	Het
L3mbtl1	T	A	2: 162,960,070		probably null	Het
Lrch1	G	A	14: 74,785,531	P634L	probably damaging	Het
Lrp1	C	T	10: 127,576,493	W1314*	probably null	Het
Lrwd1	T	A	5: 136,130,478	Y431F	probably damaging	Het
Lyst	A	G	13: 13,635,701	E652G	probably damaging	Het
Mageb3	A	G	2: 121,954,552	V223A	probably damaging	Het
Map1b	G	T	13: 99,430,644	S1856R	unknown	Het
Mecom	T	A	3: 29,965,458	Q759L	probably damaging	Het
Mfsd6	T	A	1: 52,660,975	R671S	probably benign	Het
Mllt10	A	G	2: 18,162,569	N435S	probably benign	Het
Mta2	T	C	19: 8,943,516	I27T	probably damaging	Het
Ndufab1	A	G	7: 122,101,764	L20P	probably benign	Het
Nfatc2ip	T	A	7: 126,385,108	Y371F	probably damaging	Het
Nhlrc1	A	C	13: 47,014,185	S199A	probably benign	Het
Nipa1	G	T	7: 55,985,525	N113K	possibly damaging	Het
Nlgn1	T	A	3: 26,133,265	N157I	probably damaging	Het
Nlrp1a	T	A	11: 71,114,500	K630*	probably null	Het
Nmi	T	C	2: 51,948,707	T272A	probably benign	Het
Nr1i3	T	A	1: 171,218,594	L181Q	probably damaging	Het
Nrxn1	A	T	17: 90,704,277	I308K	probably damaging	Het
Olfr1043	A	T	2: 86,162,729	Y73*	probably null	Het
Olfr150	T	A	9: 39,737,304	M163K	probably damaging	Het
Olfr294	T	C	7: 86,616,078	D189G	probably benign	Het
Olfr625-ps1	T	C	7: 103,683,312	I188T	probably damaging	Het
Osgin2	G	A	4: 16,008,648	T51M	probably damaging	Het
Pkd1l2	T	A	8: 117,030,722	T1526S	possibly damaging	Het
Pkhd1l1	G	T	15: 44,569,482	A3378S	probably damaging	Het
Plg	A	T	17: 12,384,477	D90V	probably damaging	Het
Plppr3	A	T	10: 79,865,738	D423E	probably benign	Het
Prpf8	T	C	11: 75,487,721	V66A	possibly damaging	Het
Psg19	A	T	7: 18,794,255	Y188N	probably damaging	Het
Ptgs1	C	A	2: 36,237,696	S89*	probably null	Het
Ptx3	T	A	3: 66,224,766	I236N	probably damaging	Het
Pygm	A	G	19: 6,386,408	N100S	probably damaging	Het
Reps1	A	G	10: 18,124,920	E760G	probably damaging	Het
Rgs7	T	A	1: 175,091,073	N235I	probably damaging	Het
Rgsl1	T	A	1: 153,817,549	M629L	probably benign	Het
Rrh	T	C	3: 129,810,687	I288M	probably damaging	Het
Sctr	A	T	1: 120,031,582	D70V	probably damaging	Het
Sec11c	A	T	18: 65,800,649	T9S	probably benign	Het
Spty2d1	C	T	7: 46,996,185	G570D	probably damaging	Het
Stx1b	T	C	7: 127,810,905	E153G	probably damaging	Het
Synm	G	A	7: 67,733,595	R1440W	probably benign	Het
Tcof1	T	C	18: 60,832,785	E415G	possibly damaging	Het
Tgfb1i1	G	A	7: 128,252,805	R353H	probably damaging	Het
Thbs3	T	C	3: 89,219,392	F271S	probably damaging	Het
Tlr5	T	C	1: 182,975,629	W833R	probably damaging	Het
Tmem132b	A	G	5: 125,622,551	E92G	probably damaging	Het
Tmem221	T	C	8: 71,557,828	Y133C	probably damaging	Het
Tmem229b-ps	A	G	10: 53,475,456		noncoding transcript	Het
Tnxb	T	C	17: 34,672,227	C515R	probably damaging	Het
Trp53rka	T	A	2: 165,491,495	N158I	probably damaging	Het
Tsta3	A	G	15: 75,926,142	F223S	probably damaging	Het
Usp20	T	A	2: 31,016,305	C562S	probably damaging	Het
Usp31	C	T	7: 121,648,696	V1175M	probably benign	Het
Veph1	G	T	3: 66,057,189	N806K	probably benign	Het
Vmn1r223	G	T	13: 23,249,662	C142F	probably damaging	Het
Vmn2r80	A	T	10: 79,194,724	S795C	probably benign	Het
Wdr41	A	G	13: 95,015,029		probably null	Het
Zfp617	A	T	8: 71,932,165	H113L	probably benign	Het
Zfp715	T	A	7: 43,297,946	R863S	possibly damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AACAAACGTGTCCCATCTGC -3'
(R):5'- TTTAAGGCTTCAGCTCCAAAAG -3'

Sequencing Primer
(F):5'- ACGTGTCCCATCTGCTAAAACTTTAC -3'
(R):5'- GCTATTTTCGACAATGGAGG -3'

Posted On

2014-09-18