Incidental Mutation 'R0194:Lrrc37a'
ID 23320
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Name leucine rich repeat containing 37A
Synonyms LOC237954
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R0194 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 103341535-103395423 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103390616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1603 (V1603A)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000153273
AA Change: V1603A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: V1603A

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103,391,177 (GRCm39) missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103,388,763 (GRCm39) missense unknown
IGL01352:Lrrc37a APN 11 103,390,181 (GRCm39) missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103,389,581 (GRCm39) missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103,394,687 (GRCm39) missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103,395,090 (GRCm39) missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103,389,245 (GRCm39) missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103,347,317 (GRCm39) missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103,395,365 (GRCm39) missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103,388,435 (GRCm39) missense unknown
IGL02218:Lrrc37a APN 11 103,391,207 (GRCm39) missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103,389,003 (GRCm39) missense unknown
IGL02487:Lrrc37a APN 11 103,386,863 (GRCm39) missense unknown
IGL02597:Lrrc37a APN 11 103,395,113 (GRCm39) missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103,389,938 (GRCm39) missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103,392,132 (GRCm39) missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103,382,000 (GRCm39) missense unknown
IGL02987:Lrrc37a APN 11 103,391,239 (GRCm39) missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103,347,421 (GRCm39) missense unknown
IGL03210:Lrrc37a APN 11 103,390,331 (GRCm39) missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103,390,233 (GRCm39) missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03296:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03299:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03370:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03390:Lrrc37a APN 11 103,386,857 (GRCm39) missense unknown
Lark UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
Longspur UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
F5770:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103,393,958 (GRCm39) missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103,395,338 (GRCm39) missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103,391,739 (GRCm39) missense probably benign 0.19
R0360:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103,355,221 (GRCm39) missense unknown
R0418:Lrrc37a UTSW 11 103,394,264 (GRCm39) missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103,393,851 (GRCm39) missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103,388,457 (GRCm39) missense unknown
R1581:Lrrc37a UTSW 11 103,347,843 (GRCm39) nonsense probably null
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103,347,982 (GRCm39) missense unknown
R1982:Lrrc37a UTSW 11 103,389,792 (GRCm39) missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103,391,951 (GRCm39) missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103,388,648 (GRCm39) missense unknown
R2190:Lrrc37a UTSW 11 103,390,869 (GRCm39) missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R2899:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3439:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3899:Lrrc37a UTSW 11 103,388,372 (GRCm39) missense unknown
R3916:Lrrc37a UTSW 11 103,346,344 (GRCm39) missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103,392,296 (GRCm39) missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103,348,430 (GRCm39) missense unknown
R4043:Lrrc37a UTSW 11 103,389,479 (GRCm39) missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103,388,808 (GRCm39) missense unknown
R4237:Lrrc37a UTSW 11 103,393,115 (GRCm39) missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103,392,624 (GRCm39) missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103,389,795 (GRCm39) missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103,395,363 (GRCm39) missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103,394,930 (GRCm39) missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103,346,306 (GRCm39) missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103,395,135 (GRCm39) missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103,388,438 (GRCm39) missense unknown
R4983:Lrrc37a UTSW 11 103,388,444 (GRCm39) missense unknown
R4989:Lrrc37a UTSW 11 103,347,565 (GRCm39) missense unknown
R5046:Lrrc37a UTSW 11 103,389,066 (GRCm39) missense unknown
R5217:Lrrc37a UTSW 11 103,347,780 (GRCm39) missense unknown
R5300:Lrrc37a UTSW 11 103,347,784 (GRCm39) missense unknown
R5509:Lrrc37a UTSW 11 103,391,361 (GRCm39) missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103,389,003 (GRCm39) missense unknown
R5655:Lrrc37a UTSW 11 103,389,381 (GRCm39) missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103,391,001 (GRCm39) missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103,348,923 (GRCm39) missense unknown
R5815:Lrrc37a UTSW 11 103,394,612 (GRCm39) missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103,389,897 (GRCm39) missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103,391,784 (GRCm39) missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103,393,362 (GRCm39) missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103,347,422 (GRCm39) missense unknown
R6056:Lrrc37a UTSW 11 103,388,484 (GRCm39) missense unknown
R6125:Lrrc37a UTSW 11 103,392,386 (GRCm39) missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103,392,042 (GRCm39) missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103,388,459 (GRCm39) missense unknown
R6320:Lrrc37a UTSW 11 103,394,877 (GRCm39) missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103,355,213 (GRCm39) missense unknown
R6375:Lrrc37a UTSW 11 103,391,915 (GRCm39) missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103,388,361 (GRCm39) missense unknown
R6468:Lrrc37a UTSW 11 103,351,666 (GRCm39) missense unknown
R6490:Lrrc37a UTSW 11 103,347,486 (GRCm39) missense unknown
R6502:Lrrc37a UTSW 11 103,383,005 (GRCm39) missense unknown
R6509:Lrrc37a UTSW 11 103,395,240 (GRCm39) missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103,392,923 (GRCm39) missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103,390,949 (GRCm39) missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103,348,369 (GRCm39) missense unknown
R7081:Lrrc37a UTSW 11 103,348,781 (GRCm39) missense unknown
R7083:Lrrc37a UTSW 11 103,394,166 (GRCm39) missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103,393,682 (GRCm39) missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103,348,601 (GRCm39) missense unknown
R7265:Lrrc37a UTSW 11 103,389,767 (GRCm39) missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103,347,572 (GRCm39) missense unknown
R7362:Lrrc37a UTSW 11 103,348,335 (GRCm39) missense unknown
R7450:Lrrc37a UTSW 11 103,389,152 (GRCm39) missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103,388,258 (GRCm39) missense unknown
R7487:Lrrc37a UTSW 11 103,389,045 (GRCm39) missense unknown
R7535:Lrrc37a UTSW 11 103,392,683 (GRCm39) missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103,391,778 (GRCm39) missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103,390,464 (GRCm39) missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103,389,062 (GRCm39) missense unknown
R7694:Lrrc37a UTSW 11 103,395,204 (GRCm39) missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103,395,126 (GRCm39) missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103,388,285 (GRCm39) missense unknown
R7841:Lrrc37a UTSW 11 103,391,931 (GRCm39) missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103,393,868 (GRCm39) missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103,392,307 (GRCm39) missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103,348,787 (GRCm39) missense unknown
R8051:Lrrc37a UTSW 11 103,393,952 (GRCm39) missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103,348,248 (GRCm39) missense unknown
R8097:Lrrc37a UTSW 11 103,394,925 (GRCm39) missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103,393,883 (GRCm39) missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103,388,724 (GRCm39) missense unknown
R8311:Lrrc37a UTSW 11 103,394,247 (GRCm39) missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103,392,411 (GRCm39) missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103,351,635 (GRCm39) missense unknown
R8529:Lrrc37a UTSW 11 103,348,373 (GRCm39) missense unknown
R8711:Lrrc37a UTSW 11 103,388,350 (GRCm39) nonsense probably null
R8757:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8759:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8769:Lrrc37a UTSW 11 103,389,536 (GRCm39) missense probably benign 0.10
R8785:Lrrc37a UTSW 11 103,347,242 (GRCm39) missense probably damaging 1.00
R8837:Lrrc37a UTSW 11 103,394,795 (GRCm39) missense probably benign 0.43
R8850:Lrrc37a UTSW 11 103,393,481 (GRCm39) missense
R8871:Lrrc37a UTSW 11 103,347,375 (GRCm39) missense unknown
R8894:Lrrc37a UTSW 11 103,347,449 (GRCm39) missense unknown
R8971:Lrrc37a UTSW 11 103,391,490 (GRCm39) missense probably benign 0.19
R8979:Lrrc37a UTSW 11 103,393,833 (GRCm39) missense possibly damaging 0.48
R9012:Lrrc37a UTSW 11 103,389,978 (GRCm39) missense probably benign 0.05
R9047:Lrrc37a UTSW 11 103,391,375 (GRCm39) missense probably damaging 0.97
R9167:Lrrc37a UTSW 11 103,347,658 (GRCm39) missense unknown
R9171:Lrrc37a UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
R9194:Lrrc37a UTSW 11 103,391,676 (GRCm39) missense probably benign 0.03
R9258:Lrrc37a UTSW 11 103,393,022 (GRCm39) missense probably benign 0.20
R9282:Lrrc37a UTSW 11 103,391,633 (GRCm39) missense probably benign 0.03
R9294:Lrrc37a UTSW 11 103,395,359 (GRCm39) missense probably benign 0.10
R9349:Lrrc37a UTSW 11 103,388,454 (GRCm39) missense unknown
R9560:Lrrc37a UTSW 11 103,347,420 (GRCm39) missense unknown
R9595:Lrrc37a UTSW 11 103,392,552 (GRCm39) missense probably benign 0.01
R9628:Lrrc37a UTSW 11 103,394,330 (GRCm39) missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103,390,370 (GRCm39) missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103,391,920 (GRCm39) missense probably benign 0.09
Z1176:Lrrc37a UTSW 11 103,389,860 (GRCm39) missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103,347,312 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc37a UTSW 11 103,391,346 (GRCm39) missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103,390,793 (GRCm39) missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103,393,853 (GRCm39) missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103,391,424 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCATCTTGATCCTGACCTGGTGTTG -3'
(R):5'- TCAGATTACGGAACCACCTGGAGAG -3'

Sequencing Primer
(F):5'- ATCCTGACCTGGTGTTGGAATTG -3'
(R):5'- AGTCTGGCTCAAACTGAGTATCC -3'
Posted On 2013-04-16