Incidental Mutation 'R2116:Tcof1'
ID233210
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
MMRRC Submission 040120-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60832785 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 415 (E415G)
Ref Sequence ENSEMBL: ENSMUSP00000130454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163446
AA Change: E415G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: E415G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175934
AA Change: E415G
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: E415G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176088
Predicted Effect unknown
Transcript: ENSMUST00000176630
AA Change: E415G
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: E415G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177172
AA Change: E415G
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: E415G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adamts20 A G 15: 94,355,362 C377R probably damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2098E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably null Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q759L probably damaging Het
Mfsd6 T A 1: 52,660,975 R671S probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L181Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I188T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Plppr3 A T 10: 79,865,738 D423E probably benign Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Reps1 A G 10: 18,124,920 E760G probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tgfb1i1 G A 7: 128,252,805 R353H probably damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably null Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 intron probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7863:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7946:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
RF001:Tcof1 UTSW 18 60835739 unclassified probably benign
RF005:Tcof1 UTSW 18 60833554 small insertion probably benign
RF007:Tcof1 UTSW 18 60833568 small insertion probably benign
RF009:Tcof1 UTSW 18 60835743 unclassified probably benign
RF010:Tcof1 UTSW 18 60835744 unclassified probably benign
RF011:Tcof1 UTSW 18 60835739 unclassified probably benign
RF013:Tcof1 UTSW 18 60835743 unclassified probably benign
RF015:Tcof1 UTSW 18 60833584 small insertion probably benign
RF016:Tcof1 UTSW 18 60833575 small insertion probably benign
RF022:Tcof1 UTSW 18 60835735 unclassified probably benign
RF024:Tcof1 UTSW 18 60835738 unclassified probably benign
RF027:Tcof1 UTSW 18 60835736 unclassified probably benign
RF029:Tcof1 UTSW 18 60835735 unclassified probably benign
RF029:Tcof1 UTSW 18 60835745 unclassified probably benign
RF030:Tcof1 UTSW 18 60833568 small insertion probably benign
RF030:Tcof1 UTSW 18 60833574 small insertion probably benign
RF030:Tcof1 UTSW 18 60835723 unclassified probably benign
RF031:Tcof1 UTSW 18 60833565 small insertion probably benign
RF031:Tcof1 UTSW 18 60835745 unclassified probably benign
RF035:Tcof1 UTSW 18 60833553 small insertion probably benign
RF036:Tcof1 UTSW 18 60828408 small insertion probably benign
RF036:Tcof1 UTSW 18 60835736 unclassified probably benign
RF038:Tcof1 UTSW 18 60833566 small insertion probably benign
RF040:Tcof1 UTSW 18 60828408 small insertion probably benign
RF040:Tcof1 UTSW 18 60833583 small insertion probably benign
RF041:Tcof1 UTSW 18 60833572 small insertion probably benign
RF041:Tcof1 UTSW 18 60833576 small insertion probably benign
RF043:Tcof1 UTSW 18 60833572 small insertion probably benign
RF050:Tcof1 UTSW 18 60833579 small insertion probably benign
RF051:Tcof1 UTSW 18 60833579 small insertion probably benign
RF053:Tcof1 UTSW 18 60835747 unclassified probably benign
RF056:Tcof1 UTSW 18 60833575 small insertion probably benign
RF057:Tcof1 UTSW 18 60833564 small insertion probably benign
RF057:Tcof1 UTSW 18 60833565 small insertion probably benign
RF057:Tcof1 UTSW 18 60833566 small insertion probably benign
RF057:Tcof1 UTSW 18 60833571 small insertion probably benign
RF060:Tcof1 UTSW 18 60835744 unclassified probably benign
RF060:Tcof1 UTSW 18 60835747 unclassified probably benign
RF063:Tcof1 UTSW 18 60833573 small insertion probably benign
RF064:Tcof1 UTSW 18 60833571 small insertion probably benign
RF064:Tcof1 UTSW 18 60833574 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCTTCCCCAAAGGTTTC -3'
(R):5'- TTACTGGTAAGGCTCCCTGC -3'

Sequencing Primer
(F):5'- TTTCACCTGGGAGTGACAGAG -3'
(R):5'- GCCCACATCTGCCTAATGATTTAC -3'
Posted On2014-09-18