Incidental Mutation 'R2099:Sde2'
ID233216
Institutional Source Beutler Lab
Gene Symbol Sde2
Ensembl Gene ENSMUSG00000038806
Gene NameSDE2 telomere maintenance homolog (S. pombe)
SynonymsBC031781
MMRRC Submission 040103-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R2099 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180851127-180868113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180866148 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 401 (L401P)
Ref Sequence ENSEMBL: ENSMUSP00000037890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038091]
Predicted Effect probably damaging
Transcript: ENSMUST00000038091
AA Change: L401P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037890
Gene: ENSMUSG00000038806
AA Change: L401P

DomainStartEndE-ValueType
Pfam:Telomere_Sde2 30 167 3.2e-26 PFAM
low complexity region 224 241 N/A INTRINSIC
Pfam:Telomere_Sde2_2 382 441 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194948
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,506,894 R14Q unknown Het
Aga C A 8: 53,521,131 Y286* probably null Het
Anks1 T C 17: 27,978,491 probably null Het
Arih2 A T 9: 108,616,738 F159I probably damaging Het
Asxl1 A T 2: 153,352,267 M46L possibly damaging Het
Atp23 G T 10: 126,891,726 probably null Het
Carmil1 T A 13: 24,173,667 L66F probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cramp1l A G 17: 24,973,085 V1027A probably benign Het
Cx3cr1 G A 9: 120,052,273 A21V probably benign Het
D3Ertd254e C T 3: 36,164,212 T128I possibly damaging Het
Dcxr A G 11: 120,725,577 F221S probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dnah2 T C 11: 69,493,237 D1051G probably damaging Het
Ehbp1l1 T C 19: 5,718,401 E958G possibly damaging Het
Eif3a C A 19: 60,764,113 probably benign Het
Ephb2 T C 4: 136,660,755 D678G probably damaging Het
Fam109a C T 5: 121,853,286 P237L possibly damaging Het
Fpr3 G T 17: 17,971,181 R238L probably damaging Het
Frem3 A G 8: 80,615,859 S1594G probably benign Het
Gbp4 A C 5: 105,121,081 L402W probably damaging Het
Gdpd5 T A 7: 99,448,489 L164Q probably damaging Het
Il4i1 T C 7: 44,838,192 probably null Het
Kcp G T 6: 29,496,165 C723* probably null Het
Klhl18 A G 9: 110,455,418 F2L probably damaging Het
Lepr T A 4: 101,772,988 D633E probably damaging Het
Lifr A G 15: 7,157,251 I79V probably benign Het
Mcrs1 A G 15: 99,249,946 S27P probably benign Het
Mmp3 A G 9: 7,453,672 D431G probably benign Het
Mtor T A 4: 148,550,192 Y2423* probably null Het
Ndc80 A T 17: 71,504,778 D484E probably benign Het
Ndufb8 T A 19: 44,555,310 probably benign Het
Nmur2 A T 11: 56,040,763 S41T probably benign Het
Notch2 T C 3: 98,115,321 C819R possibly damaging Het
Olfr1303 A G 2: 111,813,832 I298T probably benign Het
Olfr781 A T 10: 129,333,283 N134I probably damaging Het
Olfr958 A G 9: 39,550,667 V68A probably benign Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Samd7 T C 3: 30,756,560 V242A probably benign Het
Slc20a1 A G 2: 129,207,838 D340G probably benign Het
Slc2a5 T A 4: 150,143,177 Y484* probably null Het
Spata31d1a A G 13: 59,706,071 L27P probably damaging Het
Sqstm1 T C 11: 50,202,984 T269A possibly damaging Het
Syne2 T C 12: 75,979,973 V3525A probably benign Het
Tctn1 G A 5: 122,242,709 P512L probably damaging Het
Tlr1 A G 5: 64,925,068 F722S probably damaging Het
Treh A G 9: 44,684,646 Y376C probably damaging Het
Trim47 T C 11: 116,106,344 N529S probably damaging Het
Trrap T C 5: 144,782,239 V184A possibly damaging Het
Tyrp1 T A 4: 80,835,379 N102K possibly damaging Het
Uspl1 T A 5: 149,214,758 S724T probably damaging Het
Vmn2r2 C A 3: 64,117,053 K702N probably damaging Het
Other mutations in Sde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Sde2 APN 1 180855818 missense possibly damaging 0.77
IGL02178:Sde2 APN 1 180851231 missense possibly damaging 0.89
IGL02435:Sde2 APN 1 180866152 missense probably damaging 1.00
R0499:Sde2 UTSW 1 180862427 missense probably benign 0.05
R1891:Sde2 UTSW 1 180860008 missense probably benign 0.34
R1894:Sde2 UTSW 1 180860008 missense probably benign 0.34
R2084:Sde2 UTSW 1 180862633 missense probably damaging 0.98
R3498:Sde2 UTSW 1 180858185 missense probably damaging 1.00
R6177:Sde2 UTSW 1 180858219 missense probably damaging 0.99
R6269:Sde2 UTSW 1 180855806 missense probably benign 0.06
R6996:Sde2 UTSW 1 180851189 missense probably benign
R7058:Sde2 UTSW 1 180866262 missense probably damaging 1.00
R7197:Sde2 UTSW 1 180851278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAGGAACTGTATGCTTGTCGC -3'
(R):5'- ACAAGTCTGTCACAGCGGAG -3'

Sequencing Primer
(F):5'- TGTCTAGTCAGTAGCAGGGAG -3'
(R):5'- GGAAGTGTGCCAAGGAAATTCACTTC -3'
Posted On2014-09-18