Incidental Mutation 'R2099:Ephb2'
ID233228
Institutional Source Beutler Lab
Gene Symbol Ephb2
Ensembl Gene ENSMUSG00000028664
Gene NameEph receptor B2
SynonymsErk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk
MMRRC Submission 040103-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R2099 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136647539-136835988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136660755 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 678 (D678G)
Ref Sequence ENSEMBL: ENSMUSP00000101471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]
Predicted Effect probably damaging
Transcript: ENSMUST00000059287
AA Change: D679G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: D679G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 261 304 8.1e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 518 1.23e-10 SMART
Pfam:EphA2_TM 545 619 6e-25 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105845
AA Change: D678G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: D678G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 618 2.1e-30 PFAM
TyrKc 621 880 1.34e-138 SMART
SAM 910 977 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105846
AA Change: D679G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: D679G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 619 1e-30 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151502
Predicted Effect probably benign
Transcript: ENSMUST00000156558
SMART Domains Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664

DomainStartEndE-ValueType
FN3 1 85 6.48e1 SMART
FN3 104 186 1.23e-10 SMART
Pfam:EphA2_TM 213 276 2.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,506,894 R14Q unknown Het
Aga C A 8: 53,521,131 Y286* probably null Het
Anks1 T C 17: 27,978,491 probably null Het
Arih2 A T 9: 108,616,738 F159I probably damaging Het
Asxl1 A T 2: 153,352,267 M46L possibly damaging Het
Atp23 G T 10: 126,891,726 probably null Het
Carmil1 T A 13: 24,173,667 L66F probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cramp1l A G 17: 24,973,085 V1027A probably benign Het
Cx3cr1 G A 9: 120,052,273 A21V probably benign Het
D3Ertd254e C T 3: 36,164,212 T128I possibly damaging Het
Dcxr A G 11: 120,725,577 F221S probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dnah2 T C 11: 69,493,237 D1051G probably damaging Het
Ehbp1l1 T C 19: 5,718,401 E958G possibly damaging Het
Eif3a C A 19: 60,764,113 probably benign Het
Fam109a C T 5: 121,853,286 P237L possibly damaging Het
Fpr3 G T 17: 17,971,181 R238L probably damaging Het
Frem3 A G 8: 80,615,859 S1594G probably benign Het
Gbp4 A C 5: 105,121,081 L402W probably damaging Het
Gdpd5 T A 7: 99,448,489 L164Q probably damaging Het
Il4i1 T C 7: 44,838,192 probably null Het
Kcp G T 6: 29,496,165 C723* probably null Het
Klhl18 A G 9: 110,455,418 F2L probably damaging Het
Lepr T A 4: 101,772,988 D633E probably damaging Het
Lifr A G 15: 7,157,251 I79V probably benign Het
Mcrs1 A G 15: 99,249,946 S27P probably benign Het
Mmp3 A G 9: 7,453,672 D431G probably benign Het
Mtor T A 4: 148,550,192 Y2423* probably null Het
Ndc80 A T 17: 71,504,778 D484E probably benign Het
Ndufb8 T A 19: 44,555,310 probably benign Het
Nmur2 A T 11: 56,040,763 S41T probably benign Het
Notch2 T C 3: 98,115,321 C819R possibly damaging Het
Olfr1303 A G 2: 111,813,832 I298T probably benign Het
Olfr781 A T 10: 129,333,283 N134I probably damaging Het
Olfr958 A G 9: 39,550,667 V68A probably benign Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Samd7 T C 3: 30,756,560 V242A probably benign Het
Sde2 T C 1: 180,866,148 L401P probably damaging Het
Slc20a1 A G 2: 129,207,838 D340G probably benign Het
Slc2a5 T A 4: 150,143,177 Y484* probably null Het
Spata31d1a A G 13: 59,706,071 L27P probably damaging Het
Sqstm1 T C 11: 50,202,984 T269A possibly damaging Het
Syne2 T C 12: 75,979,973 V3525A probably benign Het
Tctn1 G A 5: 122,242,709 P512L probably damaging Het
Tlr1 A G 5: 64,925,068 F722S probably damaging Het
Treh A G 9: 44,684,646 Y376C probably damaging Het
Trim47 T C 11: 116,106,344 N529S probably damaging Het
Trrap T C 5: 144,782,239 V184A possibly damaging Het
Tyrp1 T A 4: 80,835,379 N102K possibly damaging Het
Uspl1 T A 5: 149,214,758 S724T probably damaging Het
Vmn2r2 C A 3: 64,117,053 K702N probably damaging Het
Other mutations in Ephb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ephb2 APN 4 136657484 missense probably damaging 0.96
IGL00963:Ephb2 APN 4 136658951 missense probably benign 0.04
IGL01111:Ephb2 APN 4 136657410 missense probably benign 0.01
IGL01462:Ephb2 APN 4 136771370 missense possibly damaging 0.61
IGL01863:Ephb2 APN 4 136659777 missense probably benign 0.03
IGL02149:Ephb2 APN 4 136693914 missense probably damaging 1.00
IGL02232:Ephb2 APN 4 136657451 missense probably damaging 0.97
IGL02269:Ephb2 APN 4 136771049 missense possibly damaging 0.66
IGL02828:Ephb2 APN 4 136771150 missense probably benign 0.09
IGL03109:Ephb2 APN 4 136771544 missense probably damaging 1.00
IGL03284:Ephb2 APN 4 136661516 missense probably damaging 0.96
PIT4453001:Ephb2 UTSW 4 136660810 missense probably benign 0.00
R0004:Ephb2 UTSW 4 136657524 missense probably damaging 1.00
R0121:Ephb2 UTSW 4 136771057 missense probably damaging 0.99
R0539:Ephb2 UTSW 4 136655976 missense probably damaging 1.00
R0614:Ephb2 UTSW 4 136673365 missense probably benign 0.00
R0988:Ephb2 UTSW 4 136659708 missense possibly damaging 0.59
R1471:Ephb2 UTSW 4 136658951 missense probably benign 0.04
R1473:Ephb2 UTSW 4 136694058 missense possibly damaging 0.83
R1546:Ephb2 UTSW 4 136771009 missense probably damaging 0.99
R1639:Ephb2 UTSW 4 136693905 missense probably benign 0.10
R1725:Ephb2 UTSW 4 136659778 nonsense probably null
R1779:Ephb2 UTSW 4 136693825 missense possibly damaging 0.64
R1818:Ephb2 UTSW 4 136655336 missense probably benign 0.02
R2916:Ephb2 UTSW 4 136683945 missense probably damaging 0.99
R3885:Ephb2 UTSW 4 136771034 missense probably damaging 1.00
R4572:Ephb2 UTSW 4 136655940 missense probably damaging 1.00
R4709:Ephb2 UTSW 4 136696052 missense probably damaging 1.00
R4893:Ephb2 UTSW 4 136659753 missense probably damaging 0.99
R4981:Ephb2 UTSW 4 136696010 missense probably benign 0.09
R4992:Ephb2 UTSW 4 136660839 missense probably damaging 1.00
R5004:Ephb2 UTSW 4 136659699 missense possibly damaging 0.77
R5307:Ephb2 UTSW 4 136693787 missense possibly damaging 0.89
R5370:Ephb2 UTSW 4 136771570 missense probably benign 0.00
R5561:Ephb2 UTSW 4 136661406 missense probably damaging 1.00
R5643:Ephb2 UTSW 4 136771612 missense probably damaging 0.99
R5826:Ephb2 UTSW 4 136660737 missense probably damaging 1.00
R5858:Ephb2 UTSW 4 136672445 missense probably benign
R5867:Ephb2 UTSW 4 136675422 missense possibly damaging 0.81
R5990:Ephb2 UTSW 4 136696055 missense probably benign 0.03
R6000:Ephb2 UTSW 4 136684030 missense possibly damaging 0.76
R6156:Ephb2 UTSW 4 136661505 missense probably benign 0.44
R6413:Ephb2 UTSW 4 136771122 missense probably benign 0.08
R6577:Ephb2 UTSW 4 136657550 missense probably damaging 0.99
R6633:Ephb2 UTSW 4 136683996 missense probably benign 0.07
R6720:Ephb2 UTSW 4 136657502 missense probably damaging 0.99
R6795:Ephb2 UTSW 4 136673335 missense possibly damaging 0.88
R7235:Ephb2 UTSW 4 136693828 missense probably damaging 1.00
R7260:Ephb2 UTSW 4 136771574 missense probably damaging 0.96
R7328:Ephb2 UTSW 4 136658934 critical splice donor site probably null
R7404:Ephb2 UTSW 4 136771213 missense probably damaging 1.00
R7466:Ephb2 UTSW 4 136659065 missense probably damaging 1.00
R7524:Ephb2 UTSW 4 136659709 missense probably damaging 1.00
R7605:Ephb2 UTSW 4 136771108 missense probably damaging 1.00
R7611:Ephb2 UTSW 4 136660901 critical splice acceptor site probably null
R7777:Ephb2 UTSW 4 136771636 missense possibly damaging 0.92
R7889:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
R7972:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCATTCTTGACCTAGAGC -3'
(R):5'- GGAAAGTAACACTTCTCATCTGACAC -3'

Sequencing Primer
(F):5'- CCTAGAGCTTTTTCAAGATCCAGTG -3'
(R):5'- TTCTCATCTGACACATGACACGATG -3'
Posted On2014-09-18