Incidental Mutation 'R2099:Gbp4'
ID233232
Institutional Source Beutler Lab
Gene Symbol Gbp4
Ensembl Gene ENSMUSG00000079363
Gene Nameguanylate binding protein 4
SynonymsMpa2, Mag-2, Mpa-2
MMRRC Submission 040103-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2099 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105115767-105139586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105121081 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 402 (L402W)
Ref Sequence ENSEMBL: ENSMUSP00000098522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000100961] [ENSMUST00000100962] [ENSMUST00000196204] [ENSMUST00000196677] [ENSMUST00000197799] [ENSMUST00000199629]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100962
AA Change: L402W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098522
Gene: ENSMUSG00000079363
AA Change: L402W

DomainStartEndE-ValueType
Pfam:GBP 16 287 4.2e-91 PFAM
Pfam:GBP_C 289 583 4.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196204
SMART Domains Protein: ENSMUSP00000142528
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 16 76 1e-19 PFAM
low complexity region 82 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196677
SMART Domains Protein: ENSMUSP00000142795
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 149 3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197799
SMART Domains Protein: ENSMUSP00000142493
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 16 184 3.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199629
SMART Domains Protein: ENSMUSP00000143689
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 127 1.5e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,506,894 R14Q unknown Het
Aga C A 8: 53,521,131 Y286* probably null Het
Anks1 T C 17: 27,978,491 probably null Het
Arih2 A T 9: 108,616,738 F159I probably damaging Het
Asxl1 A T 2: 153,352,267 M46L possibly damaging Het
Atp23 G T 10: 126,891,726 probably null Het
Carmil1 T A 13: 24,173,667 L66F probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cramp1l A G 17: 24,973,085 V1027A probably benign Het
Cx3cr1 G A 9: 120,052,273 A21V probably benign Het
D3Ertd254e C T 3: 36,164,212 T128I possibly damaging Het
Dcxr A G 11: 120,725,577 F221S probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dnah2 T C 11: 69,493,237 D1051G probably damaging Het
Ehbp1l1 T C 19: 5,718,401 E958G possibly damaging Het
Eif3a C A 19: 60,764,113 probably benign Het
Ephb2 T C 4: 136,660,755 D678G probably damaging Het
Fam109a C T 5: 121,853,286 P237L possibly damaging Het
Fpr3 G T 17: 17,971,181 R238L probably damaging Het
Frem3 A G 8: 80,615,859 S1594G probably benign Het
Gdpd5 T A 7: 99,448,489 L164Q probably damaging Het
Il4i1 T C 7: 44,838,192 probably null Het
Kcp G T 6: 29,496,165 C723* probably null Het
Klhl18 A G 9: 110,455,418 F2L probably damaging Het
Lepr T A 4: 101,772,988 D633E probably damaging Het
Lifr A G 15: 7,157,251 I79V probably benign Het
Mcrs1 A G 15: 99,249,946 S27P probably benign Het
Mmp3 A G 9: 7,453,672 D431G probably benign Het
Mtor T A 4: 148,550,192 Y2423* probably null Het
Ndc80 A T 17: 71,504,778 D484E probably benign Het
Ndufb8 T A 19: 44,555,310 probably benign Het
Nmur2 A T 11: 56,040,763 S41T probably benign Het
Notch2 T C 3: 98,115,321 C819R possibly damaging Het
Olfr1303 A G 2: 111,813,832 I298T probably benign Het
Olfr781 A T 10: 129,333,283 N134I probably damaging Het
Olfr958 A G 9: 39,550,667 V68A probably benign Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Samd7 T C 3: 30,756,560 V242A probably benign Het
Sde2 T C 1: 180,866,148 L401P probably damaging Het
Slc20a1 A G 2: 129,207,838 D340G probably benign Het
Slc2a5 T A 4: 150,143,177 Y484* probably null Het
Spata31d1a A G 13: 59,706,071 L27P probably damaging Het
Sqstm1 T C 11: 50,202,984 T269A possibly damaging Het
Syne2 T C 12: 75,979,973 V3525A probably benign Het
Tctn1 G A 5: 122,242,709 P512L probably damaging Het
Tlr1 A G 5: 64,925,068 F722S probably damaging Het
Treh A G 9: 44,684,646 Y376C probably damaging Het
Trim47 T C 11: 116,106,344 N529S probably damaging Het
Trrap T C 5: 144,782,239 V184A possibly damaging Het
Tyrp1 T A 4: 80,835,379 N102K possibly damaging Het
Uspl1 T A 5: 149,214,758 S724T probably damaging Het
Vmn2r2 C A 3: 64,117,053 K702N probably damaging Het
Other mutations in Gbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Gbp4 APN 5 105137021 start codon destroyed probably null 0.00
IGL01834:Gbp4 APN 5 105125602 missense probably damaging 1.00
IGL02100:Gbp4 APN 5 105122075 unclassified probably benign
IGL02119:Gbp4 APN 5 105121042 missense probably benign 0.14
IGL02364:Gbp4 APN 5 105136874 missense probably damaging 1.00
IGL03026:Gbp4 APN 5 105120000 missense possibly damaging 0.88
PIT4651001:Gbp4 UTSW 5 105118423 missense probably benign 0.08
R0147:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0148:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0413:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0415:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0478:Gbp4 UTSW 5 105119433 missense probably benign 0.01
R0546:Gbp4 UTSW 5 105120970 missense probably damaging 1.00
R0638:Gbp4 UTSW 5 105121840 missense probably damaging 0.98
R1528:Gbp4 UTSW 5 105121792 splice site probably null
R1541:Gbp4 UTSW 5 105118409 missense probably benign
R2112:Gbp4 UTSW 5 105135176 missense possibly damaging 0.95
R2994:Gbp4 UTSW 5 105137020 start codon destroyed probably null 0.86
R4021:Gbp4 UTSW 5 105120923 missense probably damaging 0.96
R4258:Gbp4 UTSW 5 105136975 missense probably damaging 1.00
R4489:Gbp4 UTSW 5 105121907 missense probably damaging 1.00
R5164:Gbp4 UTSW 5 105136877 nonsense probably null
R5195:Gbp4 UTSW 5 105119532 missense probably benign 0.00
R5406:Gbp4 UTSW 5 105119521 missense possibly damaging 0.76
R5550:Gbp4 UTSW 5 105122045 missense probably damaging 1.00
R5701:Gbp4 UTSW 5 105118399 missense possibly damaging 0.60
R5814:Gbp4 UTSW 5 105119919 missense probably benign 0.27
R6128:Gbp4 UTSW 5 105135164 missense possibly damaging 0.93
R6307:Gbp4 UTSW 5 105123109 nonsense probably null
R6513:Gbp4 UTSW 5 105123120 missense possibly damaging 0.69
R6870:Gbp4 UTSW 5 105125578 missense probably damaging 1.00
R6938:Gbp4 UTSW 5 105135077 missense probably damaging 0.99
R7063:Gbp4 UTSW 5 105118448 missense probably damaging 0.96
R7124:Gbp4 UTSW 5 105119959 missense possibly damaging 0.45
R7457:Gbp4 UTSW 5 105119553 missense probably damaging 0.98
R7615:Gbp4 UTSW 5 105122982 missense possibly damaging 0.95
R7877:Gbp4 UTSW 5 105118295 missense probably benign 0.34
R7905:Gbp4 UTSW 5 105121087 missense probably damaging 1.00
R8274:Gbp4 UTSW 5 105119472 missense probably benign 0.01
R8377:Gbp4 UTSW 5 105118462 missense probably benign 0.02
R8414:Gbp4 UTSW 5 105136837 missense probably benign 0.05
R8423:Gbp4 UTSW 5 105119934 missense probably damaging 1.00
S24628:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
X0067:Gbp4 UTSW 5 105125625 missense probably damaging 0.98
Z1088:Gbp4 UTSW 5 105120997 missense probably damaging 1.00
Z1177:Gbp4 UTSW 5 105119449 nonsense probably null
Z1177:Gbp4 UTSW 5 105125135 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- ATATTCACCCCATGCCCAGC -3'
(R):5'- TTTGAGCACCCAAGTTCAGTT -3'

Sequencing Primer
(F):5'- AATGTTCCTGGGTCTTTATCTTGTC -3'
(R):5'- GAGCACCCAAGTTCAGTTATTAGC -3'
Posted On2014-09-18