Incidental Mutation 'R0988:Mfsd14b'
ID233275
Institutional Source Beutler Lab
Gene Symbol Mfsd14b
Ensembl Gene ENSMUSG00000038212
Gene Namemajor facilitator superfamily domain containing 14B
Synonyms5730414C17Rik, Hiatl1
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0988 (G1)
Quality Score80
Status Validated
Chromosome13
Chromosomal Location65064663-65112975 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 65112493 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054730] [ENSMUST00000155487]
Predicted Effect probably benign
Transcript: ENSMUST00000054730
SMART Domains Protein: ENSMUSP00000062566
Gene: ENSMUSG00000038212

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.5e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155487
SMART Domains Protein: ENSMUSP00000118180
Gene: ENSMUSG00000038212

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.6e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220824
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Krtap4-9 T A 11: 99,785,536 C94* probably null Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Mfsd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Mfsd14b APN 13 65066701 missense probably benign 0.00
IGL01935:Mfsd14b APN 13 65067925 missense probably benign
IGL01957:Mfsd14b APN 13 65087093 missense possibly damaging 0.90
R0555:Mfsd14b UTSW 13 65078445 missense probably benign 0.34
R0601:Mfsd14b UTSW 13 65087150 missense possibly damaging 0.88
R1136:Mfsd14b UTSW 13 65095692 missense probably benign 0.22
R1494:Mfsd14b UTSW 13 65095671 missense probably damaging 1.00
R2087:Mfsd14b UTSW 13 65067982 missense probably damaging 1.00
R4223:Mfsd14b UTSW 13 65066608 utr 3 prime probably benign
R5103:Mfsd14b UTSW 13 65087093 missense possibly damaging 0.56
R5568:Mfsd14b UTSW 13 65072122 splice site probably null
R5603:Mfsd14b UTSW 13 65073606 missense probably benign 0.00
R6181:Mfsd14b UTSW 13 65112584 missense probably benign 0.00
R6330:Mfsd14b UTSW 13 65095686 missense probably damaging 1.00
R6649:Mfsd14b UTSW 13 65066785 missense probably damaging 1.00
R7460:Mfsd14b UTSW 13 65072023 missense probably damaging 1.00
R7605:Mfsd14b UTSW 13 65066777 missense probably benign
X0017:Mfsd14b UTSW 13 65072053 missense probably benign 0.08
X0027:Mfsd14b UTSW 13 65072011 missense probably benign 0.16
X0063:Mfsd14b UTSW 13 65078485 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTGGACAAAATCTGTGCCCAGAAG -3'
(R):5'- CACGACCACCACTGAATAGTTGAGG -3'

Sequencing Primer
(F):5'- TGTGCCCAGAAGATTTCTGTC -3'
(R):5'- ATCGCGGAGCCCATGAAG -3'
Posted On2014-09-18