Incidental Mutation 'R1027:Arl16'
ID233278
Institutional Source Beutler Lab
Gene Symbol Arl16
Ensembl Gene ENSMUSG00000057594
Gene NameADP-ribosylation factor-like 16
Synonyms
MMRRC Submission 039129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1027 (G1)
Quality Score70
Status Validated
Chromosome11
Chromosomal Location120464866-120467607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120465696 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 159 (A159V)
Ref Sequence ENSEMBL: ENSMUSP00000076188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000058370] [ENSMUST00000076921] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
Predicted Effect probably benign
Transcript: ENSMUST00000026900
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058370
SMART Domains Protein: ENSMUSP00000062540
Gene: ENSMUSG00000049957

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 160 189 N/A INTRINSIC
low complexity region 219 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076921
AA Change: A159V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000076188
Gene: ENSMUSG00000057594
AA Change: A159V

DomainStartEndE-ValueType
Pfam:Arf 1 169 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106203
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106205
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137639
Predicted Effect probably benign
Transcript: ENSMUST00000140862
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154136
Predicted Effect probably benign
Transcript: ENSMUST00000176120
Meta Mutation Damage Score 0.1671 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). This protein has been shown to have an inhibitory role in the cellular antiviral response. This gene product interacts with the C-terminal domain of the DEXD/H-box helicase 58 (DDX58) gene product. This interaction was found to suppress the association between the DDX58 gene product and RNA, thereby negatively regulating the activity of the DDX58 gene product. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Adamts16 A T 13: 70,767,802 V838E probably damaging Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Nop14 A G 5: 34,644,004 S608P probably damaging Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pcm1 T C 8: 41,293,445 probably benign Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Plekhh1 T C 12: 79,054,482 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rab33b T C 3: 51,484,455 S42P probably damaging Het
Rnf214 C T 9: 45,899,889 V159I probably benign Het
Sel1l3 A T 5: 53,145,478 M683K possibly damaging Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Arl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1773:Arl16 UTSW 11 120465763 missense possibly damaging 0.52
R1820:Arl16 UTSW 11 120466761 missense probably damaging 0.99
R4632:Arl16 UTSW 11 120465784 missense probably damaging 1.00
R5915:Arl16 UTSW 11 120466605 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTTGGTGGGAGACGTGAAGAC -3'
(R):5'- TTGTGGCGAGCACCACTTTGAC -3'

Sequencing Primer
(F):5'- TTGTTTACTGGTCACAGCACAG -3'
(R):5'- CATTGCTTGTGCCAAGCA -3'
Posted On2014-09-24