Incidental Mutation 'R1317:Mid1'
ID233281
Institutional Source Beutler Lab
Gene Symbol Mid1
Ensembl Gene ENSMUSG00000035299
Gene Namemidline 1
Synonyms61B3-R, Trim18, DXHXS1141, Fxy
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1317 (G1)
Quality Score55
Status Validated
ChromosomeX
Chromosomal Location169685199-170005736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 169986094 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 215 (N215H)
Ref Sequence ENSEMBL: ENSMUSP00000078412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036753] [ENSMUST00000078947] [ENSMUST00000079443] [ENSMUST00000112104] [ENSMUST00000112105] [ENSMUST00000112107] [ENSMUST00000171433] [ENSMUST00000163810]
Predicted Effect probably benign
Transcript: ENSMUST00000036753
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038765
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078947
AA Change: N457H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077974
Gene: ENSMUSG00000035299
AA Change: N457H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBC 181 307 1.47e-15 SMART
FN3 343 447 1.53e-6 SMART
Pfam:PRY 461 510 2.6e-11 PFAM
SPRY 513 632 1.12e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079443
AA Change: N215H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078412
Gene: ENSMUSG00000035299
AA Change: N215H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:BBC 21 78 1e-29 BLAST
FN3 114 205 1.91e-7 SMART
Pfam:PRY 219 268 5.1e-11 PFAM
SPRY 271 390 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112104
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107732
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112105
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107733
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 9.4e-12 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112107
AA Change: N289H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107735
Gene: ENSMUSG00000035299
AA Change: N289H

DomainStartEndE-ValueType
BBC 13 139 5.05e-14 SMART
FN3 175 279 1.53e-6 SMART
Pfam:PRY 293 342 1.7e-11 PFAM
SPRY 345 464 1.12e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144738
Predicted Effect probably benign
Transcript: ENSMUST00000171433
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126746
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163810
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128176
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151722
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous or hemizygous for disruptions in this gene have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Mid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Mid1 APN X 169927023 missense probably damaging 1.00
LCD18:Mid1 UTSW X 170005564 unclassified probably benign
R1364:Mid1 UTSW X 169986094 missense probably damaging 1.00
R1366:Mid1 UTSW X 169986094 missense probably damaging 1.00
R4452:Mid1 UTSW X 169927425 missense possibly damaging 0.62
R4678:Mid1 UTSW X 169985048 missense possibly damaging 0.79
R7100:Mid1 UTSW X 169985077 missense probably benign 0.43
R7554:Mid1 UTSW X 169986014 missense possibly damaging 0.93
R8510:Mid1 UTSW X 169985023 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTGTGTAACTCGGCGGACAGC -3'
(R):5'- ACCCTGAGTGACCATGTGAGGC -3'

Sequencing Primer
(F):5'- ATCTTCACGGTGAAGGCCAT -3'
(R):5'- TGTGAGACATGGGGATGACTG -3'
Posted On2014-09-24