Incidental Mutation 'R1364:Tll2'
ID233289
Institutional Source Beutler Lab
Gene Symbol Tll2
Ensembl Gene ENSMUSG00000025013
Gene Nametolloid-like 2
Synonyms
MMRRC Submission 039429-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R1364 (G1)
Quality Score80
Status Validated
Chromosome19
Chromosomal Location41083981-41206774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41120228 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 328 (R328C)
Ref Sequence ENSEMBL: ENSMUSP00000025986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]
Predicted Effect probably damaging
Transcript: ENSMUST00000025986
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: R328C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 348 460 7.69e-44 SMART
CUB 461 573 8.69e-52 SMART
EGF_CA 573 614 1.26e-11 SMART
CUB 617 729 3.99e-51 SMART
EGF_CA 729 769 5.92e-8 SMART
CUB 773 885 3.08e-43 SMART
CUB 886 1002 2.25e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169941
SMART Domains Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 331 443 7.69e-44 SMART
CUB 444 556 8.69e-52 SMART
EGF_CA 556 597 1.26e-11 SMART
CUB 600 712 3.99e-51 SMART
EGF_CA 712 752 5.92e-8 SMART
CUB 756 868 3.08e-43 SMART
CUB 869 985 2.25e-36 SMART
Meta Mutation Damage Score 0.5467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,987,030 F2519S probably damaging Het
Ahi1 T A 10: 20,972,156 L488I probably damaging Het
Cobll1 A G 2: 65,126,310 probably benign Het
Csn1s1 T C 5: 87,677,584 probably benign Het
D430041D05Rik A T 2: 104,155,018 S1920T possibly damaging Het
Dnah17 T A 11: 118,125,606 probably benign Het
Fam126a T C 5: 23,965,353 T333A probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Fnbp1 T C 2: 31,059,031 probably benign Het
Herc1 T A 9: 66,400,093 L1023Q probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Kcnt1 A G 2: 25,908,094 M906V probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mug1 T A 6: 121,881,713 L1130Q probably damaging Het
Nebl A T 2: 17,393,037 probably benign Het
Olfr1491 T C 19: 13,705,445 V206A probably benign Het
Otud7b A G 3: 96,151,451 D320G probably damaging Het
Piezo1 T C 8: 122,498,571 E563G possibly damaging Het
Prkd3 T C 17: 78,957,258 T643A probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Ripk3 A C 14: 55,785,260 probably null Het
Sgsm3 T C 15: 81,007,942 F237S probably damaging Het
Slit3 G A 11: 35,670,107 V960I probably benign Het
Sptbn2 T C 19: 4,732,665 L543P probably damaging Het
Unkl A G 17: 25,189,623 I54V probably benign Het
Wdr75 A G 1: 45,799,062 T44A probably benign Het
Other mutations in Tll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Tll2 APN 19 41086366 missense probably benign 0.01
IGL02028:Tll2 APN 19 41098649 nonsense probably null
IGL02146:Tll2 APN 19 41097837 missense probably benign 0.00
IGL02192:Tll2 APN 19 41086263 missense possibly damaging 0.73
IGL02544:Tll2 APN 19 41135965 missense probably damaging 1.00
PIT4677001:Tll2 UTSW 19 41130558 missense probably benign 0.14
R0141:Tll2 UTSW 19 41097912 missense probably damaging 1.00
R0372:Tll2 UTSW 19 41183313 critical splice acceptor site probably null
R0393:Tll2 UTSW 19 41088826 missense possibly damaging 0.95
R0402:Tll2 UTSW 19 41098693 missense possibly damaging 0.56
R0613:Tll2 UTSW 19 41104990 missense probably damaging 0.97
R0756:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0757:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R0790:Tll2 UTSW 19 41103850 missense probably damaging 0.98
R0834:Tll2 UTSW 19 41113073 missense probably damaging 1.00
R0843:Tll2 UTSW 19 41128463 splice site probably null
R1014:Tll2 UTSW 19 41103851 missense probably damaging 1.00
R1178:Tll2 UTSW 19 41092847 missense probably damaging 1.00
R1233:Tll2 UTSW 19 41095984 missense possibly damaging 0.79
R1367:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1368:Tll2 UTSW 19 41120228 missense probably damaging 1.00
R1519:Tll2 UTSW 19 41086400 missense probably benign 0.17
R1894:Tll2 UTSW 19 41088671 critical splice donor site probably null
R1896:Tll2 UTSW 19 41113059 missense probably benign 0.44
R1917:Tll2 UTSW 19 41128497 missense possibly damaging 0.83
R2170:Tll2 UTSW 19 41183275 missense probably damaging 1.00
R4433:Tll2 UTSW 19 41121348 missense probably benign 0.03
R4617:Tll2 UTSW 19 41098636 missense probably benign 0.31
R4831:Tll2 UTSW 19 41130512 missense probably damaging 1.00
R5057:Tll2 UTSW 19 41117266 missense probably benign 0.02
R5119:Tll2 UTSW 19 41130509 missense possibly damaging 0.48
R5194:Tll2 UTSW 19 41095897 missense probably damaging 1.00
R5280:Tll2 UTSW 19 41117257 missense possibly damaging 0.87
R5602:Tll2 UTSW 19 41104981 missense possibly damaging 0.63
R5800:Tll2 UTSW 19 41104934 missense probably benign 0.10
R6223:Tll2 UTSW 19 41135952 missense possibly damaging 0.54
R7047:Tll2 UTSW 19 41086240 missense probably damaging 0.99
R7155:Tll2 UTSW 19 41117284 missense possibly damaging 0.72
R7213:Tll2 UTSW 19 41120227 missense probably damaging 0.97
R7231:Tll2 UTSW 19 41086234 missense probably benign 0.02
R7390:Tll2 UTSW 19 41120169 critical splice donor site probably null
R7414:Tll2 UTSW 19 41103829 missense probably damaging 0.98
R7757:Tll2 UTSW 19 41096008 missense probably damaging 1.00
R8165:Tll2 UTSW 19 41088874 missense possibly damaging 0.79
R8418:Tll2 UTSW 19 41092837 missense probably damaging 1.00
X0027:Tll2 UTSW 19 41183303 missense probably damaging 1.00
Z1177:Tll2 UTSW 19 41092734 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTTGGAGCAACGTTCCACACTG -3'
(R):5'- GAGTCTCCTCACACATAGCTTGGC -3'

Sequencing Primer
(F):5'- CCACACTGTGCTGGATAATTGAG -3'
(R):5'- CAGCCTTGACTTTtctccctc -3'
Posted On2014-10-01