Mutagenetix > Incidental Mutations

Incidental Mutation 'R1364:Tll2'

233289

Institutional Source

Beutler Lab

Gene Symbol

Tll2

Ensembl Gene

ENSMUSG00000025013

Gene Name

tolloid-like 2

Synonyms

MMRRC Submission

039429-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R1364 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

41083981-41206774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41120228 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 328 (R328C)

Ref Sequence

ENSEMBL: ENSMUSP00000025986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025986
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: R328C

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
ZnMc	152	294	1.15e-54	SMART
CUB	348	460	7.69e-44	SMART
CUB	461	573	8.69e-52	SMART
EGF_CA	573	614	1.26e-11	SMART
CUB	617	729	3.99e-51	SMART
EGF_CA	729	769	5.92e-8	SMART
CUB	773	885	3.08e-43	SMART
CUB	886	1002	2.25e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169941

SMART Domains

Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
ZnMc	152	294	1.15e-54	SMART
CUB	331	443	7.69e-44	SMART
CUB	444	556	8.69e-52	SMART
EGF_CA	556	597	1.26e-11	SMART
CUB	600	712	3.99e-51	SMART
EGF_CA	712	752	5.92e-8	SMART
CUB	756	868	3.08e-43	SMART
CUB	869	985	2.25e-36	SMART

Meta Mutation Damage Score

0.5467

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.8%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,987,030	F2519S	probably damaging	Het
Ahi1	T	A	10: 20,972,156	L488I	probably damaging	Het
Cobll1	A	G	2: 65,126,310		probably benign	Het
Csn1s1	T	C	5: 87,677,584		probably benign	Het
D430041D05Rik	A	T	2: 104,155,018	S1920T	possibly damaging	Het
Dnah17	T	A	11: 118,125,606		probably benign	Het
Fam126a	T	C	5: 23,965,353	T333A	probably benign	Het
Fanca	G	A	8: 123,304,281		probably benign	Het
Fnbp1	T	C	2: 31,059,031		probably benign	Het
Herc1	T	A	9: 66,400,093	L1023Q	probably damaging	Het
Hjurp	T	TN	1: 88,266,525		probably null	Het
Kcnt1	A	G	2: 25,908,094	M906V	probably damaging	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mid1	A	C	X: 169,986,094	N215H	probably damaging	Het
Mug1	T	A	6: 121,881,713	L1130Q	probably damaging	Het
Nebl	A	T	2: 17,393,037		probably benign	Het
Olfr1491	T	C	19: 13,705,445	V206A	probably benign	Het
Otud7b	A	G	3: 96,151,451	D320G	probably damaging	Het
Piezo1	T	C	8: 122,498,571	E563G	possibly damaging	Het
Prkd3	T	C	17: 78,957,258	T643A	probably damaging	Het
Prl3b1	G	A	13: 27,243,865	A53T	probably benign	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Ripk3	A	C	14: 55,785,260		probably null	Het
Sgsm3	T	C	15: 81,007,942	F237S	probably damaging	Het
Slit3	G	A	11: 35,670,107	V960I	probably benign	Het
Sptbn2	T	C	19: 4,732,665	L543P	probably damaging	Het
Unkl	A	G	17: 25,189,623	I54V	probably benign	Het
Wdr75	A	G	1: 45,799,062	T44A	probably benign	Het

Other mutations in Tll2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01555:Tll2	APN	19	41086366	missense	probably benign	0.01
IGL02028:Tll2	APN	19	41098649	nonsense	probably null
IGL02146:Tll2	APN	19	41097837	missense	probably benign	0.00
IGL02192:Tll2	APN	19	41086263	missense	possibly damaging	0.73
IGL02544:Tll2	APN	19	41135965	missense	probably damaging	1.00
PIT4677001:Tll2	UTSW	19	41130558	missense	probably benign	0.14
R0141:Tll2	UTSW	19	41097912	missense	probably damaging	1.00
R0372:Tll2	UTSW	19	41183313	critical splice acceptor site	probably null
R0393:Tll2	UTSW	19	41088826	missense	possibly damaging	0.95
R0402:Tll2	UTSW	19	41098693	missense	possibly damaging	0.56
R0613:Tll2	UTSW	19	41104990	missense	probably damaging	0.97
R0756:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R0757:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R0790:Tll2	UTSW	19	41103850	missense	probably damaging	0.98
R0834:Tll2	UTSW	19	41113073	missense	probably damaging	1.00
R0843:Tll2	UTSW	19	41128463	splice site	probably null
R1014:Tll2	UTSW	19	41103851	missense	probably damaging	1.00
R1178:Tll2	UTSW	19	41092847	missense	probably damaging	1.00
R1233:Tll2	UTSW	19	41095984	missense	possibly damaging	0.79
R1367:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1368:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1519:Tll2	UTSW	19	41086400	missense	probably benign	0.17
R1894:Tll2	UTSW	19	41088671	critical splice donor site	probably null
R1896:Tll2	UTSW	19	41113059	missense	probably benign	0.44
R1917:Tll2	UTSW	19	41128497	missense	possibly damaging	0.83
R2170:Tll2	UTSW	19	41183275	missense	probably damaging	1.00
R4433:Tll2	UTSW	19	41121348	missense	probably benign	0.03
R4617:Tll2	UTSW	19	41098636	missense	probably benign	0.31
R4831:Tll2	UTSW	19	41130512	missense	probably damaging	1.00
R5057:Tll2	UTSW	19	41117266	missense	probably benign	0.02
R5119:Tll2	UTSW	19	41130509	missense	possibly damaging	0.48
R5194:Tll2	UTSW	19	41095897	missense	probably damaging	1.00
R5280:Tll2	UTSW	19	41117257	missense	possibly damaging	0.87
R5602:Tll2	UTSW	19	41104981	missense	possibly damaging	0.63
R5800:Tll2	UTSW	19	41104934	missense	probably benign	0.10
R6223:Tll2	UTSW	19	41135952	missense	possibly damaging	0.54
R7047:Tll2	UTSW	19	41086240	missense	probably damaging	0.99
R7155:Tll2	UTSW	19	41117284	missense	possibly damaging	0.72
R7213:Tll2	UTSW	19	41120227	missense	probably damaging	0.97
R7231:Tll2	UTSW	19	41086234	missense	probably benign	0.02
R7390:Tll2	UTSW	19	41120169	critical splice donor site	probably null
R7414:Tll2	UTSW	19	41103829	missense	probably damaging	0.98
R7757:Tll2	UTSW	19	41096008	missense	probably damaging	1.00
R8165:Tll2	UTSW	19	41088874	missense	possibly damaging	0.79
R8418:Tll2	UTSW	19	41092837	missense	probably damaging	1.00
X0027:Tll2	UTSW	19	41183303	missense	probably damaging	1.00
Z1177:Tll2	UTSW	19	41092734	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TCTTGGAGCAACGTTCCACACTG -3'
(R):5'- GAGTCTCCTCACACATAGCTTGGC -3'

Sequencing Primer
(F):5'- CCACACTGTGCTGGATAATTGAG -3'
(R):5'- CAGCCTTGACTTTtctccctc -3'

Posted On

2014-10-01