Incidental Mutation 'R0194:Fam186a'
ID 23329
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Name family with sequence similarity 186, member A
Synonyms LOC380973, 1700030F18Rik
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R0194 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99816229-99864942 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99839644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 2200 (T2200I)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000100209
AA Change: T2200I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: T2200I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180309
Meta Mutation Damage Score 0.4309 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99,825,572 (GRCm39) splice site probably benign
IGL03047:Fam186a UTSW 15 99,843,589 (GRCm39) missense unknown
R0172:Fam186a UTSW 15 99,852,768 (GRCm39) missense unknown
R0381:Fam186a UTSW 15 99,840,055 (GRCm39) missense probably damaging 0.97
R0799:Fam186a UTSW 15 99,839,893 (GRCm39) missense probably damaging 1.00
R1295:Fam186a UTSW 15 99,837,670 (GRCm39) splice site probably benign
R1366:Fam186a UTSW 15 99,841,270 (GRCm39) missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99,845,536 (GRCm39) missense unknown
R1592:Fam186a UTSW 15 99,838,199 (GRCm39) missense probably benign 0.01
R1636:Fam186a UTSW 15 99,839,539 (GRCm39) missense unknown
R1719:Fam186a UTSW 15 99,840,227 (GRCm39) missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99,864,762 (GRCm39) nonsense probably null
R1856:Fam186a UTSW 15 99,838,183 (GRCm39) missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99,831,557 (GRCm39) unclassified probably benign
R2192:Fam186a UTSW 15 99,838,192 (GRCm39) missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99,852,745 (GRCm39) missense unknown
R2251:Fam186a UTSW 15 99,842,978 (GRCm39) missense probably benign 0.02
R2902:Fam186a UTSW 15 99,843,049 (GRCm39) missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99,841,675 (GRCm39) missense probably damaging 0.99
R3744:Fam186a UTSW 15 99,845,416 (GRCm39) missense unknown
R4021:Fam186a UTSW 15 99,839,680 (GRCm39) missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99,831,566 (GRCm39) unclassified probably benign
R4238:Fam186a UTSW 15 99,841,523 (GRCm39) missense probably benign 0.05
R4667:Fam186a UTSW 15 99,842,413 (GRCm39) missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99,831,419 (GRCm39) unclassified probably benign
R4835:Fam186a UTSW 15 99,843,689 (GRCm39) missense unknown
R4837:Fam186a UTSW 15 99,838,678 (GRCm39) missense unknown
R4897:Fam186a UTSW 15 99,843,158 (GRCm39) missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99,844,723 (GRCm39) missense unknown
R4950:Fam186a UTSW 15 99,839,534 (GRCm39) missense unknown
R4995:Fam186a UTSW 15 99,842,980 (GRCm39) missense probably benign 0.27
R5062:Fam186a UTSW 15 99,842,527 (GRCm39) missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99,840,977 (GRCm39) missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99,853,374 (GRCm39) missense unknown
R5424:Fam186a UTSW 15 99,843,644 (GRCm39) missense unknown
R5624:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99,844,931 (GRCm39) missense unknown
R5652:Fam186a UTSW 15 99,843,253 (GRCm39) missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99,864,705 (GRCm39) nonsense probably null
R5965:Fam186a UTSW 15 99,842,978 (GRCm39) missense probably benign 0.37
R6044:Fam186a UTSW 15 99,839,878 (GRCm39) missense probably damaging 0.97
R6077:Fam186a UTSW 15 99,840,584 (GRCm39) missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99,838,244 (GRCm39) missense probably benign 0.00
R6185:Fam186a UTSW 15 99,845,530 (GRCm39) missense unknown
R6186:Fam186a UTSW 15 99,845,206 (GRCm39) missense unknown
R6242:Fam186a UTSW 15 99,837,788 (GRCm39) missense unknown
R6351:Fam186a UTSW 15 99,839,623 (GRCm39) missense probably damaging 0.97
R6368:Fam186a UTSW 15 99,841,198 (GRCm39) missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99,845,212 (GRCm39) missense unknown
R6559:Fam186a UTSW 15 99,842,356 (GRCm39) missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99,852,756 (GRCm39) missense unknown
R6867:Fam186a UTSW 15 99,843,731 (GRCm39) missense unknown
R6957:Fam186a UTSW 15 99,844,357 (GRCm39) missense unknown
R6961:Fam186a UTSW 15 99,838,082 (GRCm39) missense probably benign 0.16
R6994:Fam186a UTSW 15 99,840,347 (GRCm39) missense probably benign 0.35
R6996:Fam186a UTSW 15 99,853,374 (GRCm39) missense unknown
R7062:Fam186a UTSW 15 99,831,521 (GRCm39) unclassified probably benign
R7064:Fam186a UTSW 15 99,839,557 (GRCm39) missense unknown
R7173:Fam186a UTSW 15 99,843,531 (GRCm39) missense unknown
R7244:Fam186a UTSW 15 99,844,273 (GRCm39) missense unknown
R7270:Fam186a UTSW 15 99,842,033 (GRCm39) missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99,844,826 (GRCm39) nonsense probably null
R7437:Fam186a UTSW 15 99,840,775 (GRCm39) missense probably damaging 1.00
R7475:Fam186a UTSW 15 99,845,395 (GRCm39) missense unknown
R7487:Fam186a UTSW 15 99,840,017 (GRCm39) missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99,839,796 (GRCm39) missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99,837,788 (GRCm39) missense unknown
R7658:Fam186a UTSW 15 99,837,725 (GRCm39) missense unknown
R7663:Fam186a UTSW 15 99,842,950 (GRCm39) missense probably benign 0.00
R7703:Fam186a UTSW 15 99,852,678 (GRCm39) missense unknown
R7814:Fam186a UTSW 15 99,842,545 (GRCm39) missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99,841,189 (GRCm39) missense probably damaging 0.99
R7970:Fam186a UTSW 15 99,831,467 (GRCm39) missense unknown
R8076:Fam186a UTSW 15 99,841,351 (GRCm39) missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99,839,725 (GRCm39) missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99,841,914 (GRCm39) frame shift probably null
R8239:Fam186a UTSW 15 99,839,191 (GRCm39) missense unknown
R8246:Fam186a UTSW 15 99,838,428 (GRCm39) missense unknown
R8446:Fam186a UTSW 15 99,845,335 (GRCm39) missense unknown
R8469:Fam186a UTSW 15 99,845,186 (GRCm39) missense unknown
R8676:Fam186a UTSW 15 99,845,023 (GRCm39) missense unknown
R8790:Fam186a UTSW 15 99,841,024 (GRCm39) missense possibly damaging 0.90
R8808:Fam186a UTSW 15 99,842,604 (GRCm39) missense possibly damaging 0.83
R8848:Fam186a UTSW 15 99,838,034 (GRCm39) missense possibly damaging 0.83
R9083:Fam186a UTSW 15 99,843,079 (GRCm39) missense probably benign 0.27
R9106:Fam186a UTSW 15 99,844,107 (GRCm39) small deletion probably benign
R9116:Fam186a UTSW 15 99,840,472 (GRCm39) missense possibly damaging 0.95
R9156:Fam186a UTSW 15 99,841,159 (GRCm39) missense possibly damaging 0.46
R9227:Fam186a UTSW 15 99,853,384 (GRCm39) missense unknown
R9250:Fam186a UTSW 15 99,845,330 (GRCm39) missense unknown
R9282:Fam186a UTSW 15 99,839,879 (GRCm39) missense probably damaging 0.97
R9495:Fam186a UTSW 15 99,844,766 (GRCm39) missense unknown
R9514:Fam186a UTSW 15 99,844,766 (GRCm39) missense unknown
R9521:Fam186a UTSW 15 99,841,471 (GRCm39) missense probably damaging 0.97
R9553:Fam186a UTSW 15 99,844,561 (GRCm39) missense unknown
R9641:Fam186a UTSW 15 99,838,244 (GRCm39) missense probably benign 0.00
R9655:Fam186a UTSW 15 99,840,973 (GRCm39) missense probably damaging 0.99
R9661:Fam186a UTSW 15 99,842,492 (GRCm39) missense possibly damaging 0.66
R9673:Fam186a UTSW 15 99,841,024 (GRCm39) missense possibly damaging 0.90
R9762:Fam186a UTSW 15 99,842,393 (GRCm39) missense possibly damaging 0.66
X0021:Fam186a UTSW 15 99,843,316 (GRCm39) missense probably benign 0.00
Z1088:Fam186a UTSW 15 99,843,875 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGACTTCTCTGGGCTTCAAGTTGC -3'
(R):5'- TGAGGACCAGTTTCCCCACTAAGG -3'

Sequencing Primer
(F):5'- TGCTTCTTAGAAAGATGGCTCC -3'
(R):5'- GGTAATGAAGATTTGCCTCACCC -3'
Posted On 2013-04-16