Incidental Mutation 'E0374:Trabd2b'
ID233309
Institutional Source Beutler Lab
Gene Symbol Trabd2b
Ensembl Gene ENSMUSG00000070867
Gene NameTraB domain containing 2B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #E0374 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location114406724-114615098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 114599897 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 337 (V337G)
Ref Sequence ENSEMBL: ENSMUSP00000092494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094894]
Predicted Effect probably damaging
Transcript: ENSMUST00000094894
AA Change: V337G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092494
Gene: ENSMUSG00000070867
AA Change: V337G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TraB 41 350 6.2e-67 PFAM
low complexity region 359 402 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 450 469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 A G 6: 87,255,879 S234P probably benign Het
Bbox1 A G 2: 110,268,311 V307A probably damaging Het
Ccr6 T C 17: 8,256,452 V163A probably damaging Het
Cdkn3 C A 14: 46,767,173 probably null Het
Chst13 C A 6: 90,309,192 E263* probably null Het
Dctn1 T A 6: 83,194,174 C754S possibly damaging Het
Dlgap4 T G 2: 156,761,843 I185S probably damaging Het
Heca T A 10: 17,908,176 H443L probably damaging Het
Klkb1 C T 8: 45,289,091 M50I possibly damaging Het
Lamb1 A G 12: 31,287,930 Y414C probably damaging Het
Maff C A 15: 79,357,675 N97K probably damaging Het
Map1s T A 8: 70,906,017 probably benign Het
Mfsd10 A T 5: 34,636,637 probably null Het
Nfam1 T G 15: 83,016,410 I124L probably benign Het
Omg T G 11: 79,502,949 I28L probably benign Het
Pfkm A T 15: 98,123,233 I311F probably damaging Het
Sap30 T A 8: 57,485,061 N174I probably damaging Het
Sdc1 T A 12: 8,789,424 N28K probably damaging Het
Other mutations in Trabd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Trabd2b APN 4 114409125 missense probably damaging 0.99
IGL01404:Trabd2b APN 4 114599956 missense probably benign 0.01
IGL01866:Trabd2b APN 4 114408920 missense probably damaging 0.96
IGL03056:Trabd2b APN 4 114409338 missense probably damaging 0.96
IGL03167:Trabd2b APN 4 114609998 missense probably benign
R0645:Trabd2b UTSW 4 114586570 missense probably damaging 1.00
R0744:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R0833:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R1580:Trabd2b UTSW 4 114580334 missense possibly damaging 0.91
R1599:Trabd2b UTSW 4 114408981 missense probably damaging 0.99
R2132:Trabd2b UTSW 4 114610008 missense probably benign
R2133:Trabd2b UTSW 4 114610008 missense probably benign
R2204:Trabd2b UTSW 4 114602994 missense probably damaging 1.00
R2518:Trabd2b UTSW 4 114599903 missense probably damaging 1.00
R4940:Trabd2b UTSW 4 114408944 missense probably damaging 1.00
R4994:Trabd2b UTSW 4 114406855 missense probably benign 0.05
R5104:Trabd2b UTSW 4 114406917 missense probably benign 0.21
R5219:Trabd2b UTSW 4 114602810 missense probably damaging 0.97
R6456:Trabd2b UTSW 4 114586560 missense probably damaging 1.00
R7148:Trabd2b UTSW 4 114409350 missense probably damaging 1.00
R7192:Trabd2b UTSW 4 114610020 missense possibly damaging 0.88
R7195:Trabd2b UTSW 4 114409440 missense probably damaging 1.00
R7375:Trabd2b UTSW 4 114609997 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATTCTACGTCTCAATACCC -3'
(R):5'- CAATGCCTGGTTCAGTTTGTTC -3'

Sequencing Primer
(F):5'- TACCCGTCCTGAAGACCATTGG -3'
(R):5'- GAGAACACGCAGTCTGTTTC -3'
Posted On2014-10-01