Incidental Mutation 'E0374:Sdc1'
ID233322
Institutional Source Beutler Lab
Gene Symbol Sdc1
Ensembl Gene ENSMUSG00000020592
Gene Namesyndecan 1
SynonymsSynd1, syn-1, CD138, Synd
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #E0374 (G1)
Quality Score222
Status Not validated
Chromosome12
Chromosomal Location8771323-8793715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8789424 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 28 (N28K)
Ref Sequence ENSEMBL: ENSMUSP00000131491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020911] [ENSMUST00000161883] [ENSMUST00000171158]
Predicted Effect probably damaging
Transcript: ENSMUST00000020911
AA Change: N28K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020911
Gene: ENSMUSG00000020592
AA Change: N28K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
4.1m 276 294 5.47e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160348
Predicted Effect possibly damaging
Transcript: ENSMUST00000161883
AA Change: N32K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123896
Gene: ENSMUSG00000020592
AA Change: N32K

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
low complexity region 141 156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171158
AA Change: N28K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131491
Gene: ENSMUSG00000020592
AA Change: N28K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
4.1m 276 294 5.47e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-1 expression has been detected in several different tumor types. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutant mice are overtly normal but resist mammary tumor development in response to Wnt1, and show delayed cutaneous and corneal wound healing, defective leukocyte adhesion to endothelia, increased angiogenesis, as well as reduced susceptibility to P. aeruginosa lung infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 A G 6: 87,255,879 S234P probably benign Het
Bbox1 A G 2: 110,268,311 V307A probably damaging Het
Ccr6 T C 17: 8,256,452 V163A probably damaging Het
Cdkn3 C A 14: 46,767,173 probably null Het
Chst13 C A 6: 90,309,192 E263* probably null Het
Dctn1 T A 6: 83,194,174 C754S possibly damaging Het
Dlgap4 T G 2: 156,761,843 I185S probably damaging Het
Heca T A 10: 17,908,176 H443L probably damaging Het
Klkb1 C T 8: 45,289,091 M50I possibly damaging Het
Lamb1 A G 12: 31,287,930 Y414C probably damaging Het
Maff C A 15: 79,357,675 N97K probably damaging Het
Map1s T A 8: 70,906,017 probably benign Het
Mfsd10 A T 5: 34,636,637 probably null Het
Nfam1 T G 15: 83,016,410 I124L probably benign Het
Omg T G 11: 79,502,949 I28L probably benign Het
Pfkm A T 15: 98,123,233 I311F probably damaging Het
Sap30 T A 8: 57,485,061 N174I probably damaging Het
Trabd2b T G 4: 114,599,897 V337G probably damaging Het
Other mutations in Sdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Sdc1 APN 12 8790459 missense possibly damaging 0.75
IGL02197:Sdc1 APN 12 8790835 missense possibly damaging 0.90
R1673:Sdc1 UTSW 12 8790409 missense possibly damaging 0.66
R4700:Sdc1 UTSW 12 8790541 missense possibly damaging 0.82
R4887:Sdc1 UTSW 12 8791708 missense probably damaging 1.00
R5396:Sdc1 UTSW 12 8791743 unclassified probably null
R6358:Sdc1 UTSW 12 8791297 missense probably damaging 0.99
R7272:Sdc1 UTSW 12 8790554 missense probably benign 0.41
R7575:Sdc1 UTSW 12 8790619 missense probably damaging 1.00
R7741:Sdc1 UTSW 12 8791370 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCACCAGGCTATGATGTTATGG -3'
(R):5'- CTCCAATGGCTAAGGATGGG -3'

Sequencing Primer
(F):5'- CACCAGGCTATGATGTTATGGCATTG -3'
(R):5'- CCAATGGCTAAGGATGGGATGGG -3'
Posted On2014-10-01