Incidental Mutation 'R0194:Dsg3'
ID 23334
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Name desmoglein 3
Synonyms
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock # R0194 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20510304-20541310 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20540142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 957 (T957A)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000070892
AA Change: T957A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: T957A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Meta Mutation Damage Score 0.4209 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4616:Dsg3 UTSW 18 20531559 missense probably benign
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
R7357:Dsg3 UTSW 18 20539783 missense probably damaging 1.00
R7385:Dsg3 UTSW 18 20540197 missense possibly damaging 0.52
R7456:Dsg3 UTSW 18 20531363 missense probably benign 0.17
R7506:Dsg3 UTSW 18 20533464 missense probably benign 0.31
R7570:Dsg3 UTSW 18 20527780 missense possibly damaging 0.95
R7980:Dsg3 UTSW 18 20531360 missense probably benign 0.00
R8100:Dsg3 UTSW 18 20528971 missense probably benign 0.08
R8147:Dsg3 UTSW 18 20540073 missense probably benign
R8242:Dsg3 UTSW 18 20536923 missense possibly damaging 0.93
R8415:Dsg3 UTSW 18 20523708 missense probably damaging 1.00
R8494:Dsg3 UTSW 18 20540214 missense probably benign 0.03
R8930:Dsg3 UTSW 18 20539661 missense probably damaging 1.00
R8932:Dsg3 UTSW 18 20539661 missense probably damaging 1.00
R8998:Dsg3 UTSW 18 20533627 missense probably damaging 1.00
R8999:Dsg3 UTSW 18 20533627 missense probably damaging 1.00
R9336:Dsg3 UTSW 18 20524685 missense probably benign 0.19
R9498:Dsg3 UTSW 18 20525221 missense probably damaging 0.98
R9598:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R9601:Dsg3 UTSW 18 20533521 missense probably damaging 1.00
R9748:Dsg3 UTSW 18 20539704 missense possibly damaging 0.87
R9794:Dsg3 UTSW 18 20540097 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTCTGGAAGTCACCCAAAC -3'
(R):5'- GCATTTTAAGGCAACAGCATCTCCC -3'

Sequencing Primer
(F):5'- GGTTCTAAAATATGCCACACGCTG -3'
(R):5'- GATGCTTGGGAAATATACCTGTC -3'
Posted On 2013-04-16