Incidental Mutation 'R0194:Slc12a2'
ID 23335
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Name solute carrier family 12, member 2
Synonyms sy-ns, Nkcc1, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0194 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 58011750-58079893 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58063283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 921 (D921G)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000115366
AA Change: D921G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: D921G

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Meta Mutation Damage Score 0.5144 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 58,069,477 (GRCm39) missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 58,039,092 (GRCm39) nonsense probably null
IGL01896:Slc12a2 APN 18 58,029,380 (GRCm39) missense probably benign 0.06
IGL02266:Slc12a2 APN 18 58,045,092 (GRCm39) splice site probably benign
IGL02489:Slc12a2 APN 18 58,045,074 (GRCm39) missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 58,012,471 (GRCm39) missense probably benign 0.25
IGL03068:Slc12a2 APN 18 58,037,407 (GRCm39) splice site probably benign
IGL03076:Slc12a2 APN 18 58,059,469 (GRCm39) splice site probably benign
IGL03086:Slc12a2 APN 18 58,054,856 (GRCm39) missense probably benign 0.00
IGL03238:Slc12a2 APN 18 58,047,306 (GRCm39) missense possibly damaging 0.85
frankie UTSW 18 58,068,035 (GRCm39) missense possibly damaging 0.48
honeylamb UTSW 18 58,063,238 (GRCm39) missense probably damaging 1.00
sugar UTSW 18 58,032,344 (GRCm39) missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 58,048,594 (GRCm39) splice site probably benign
R0530:Slc12a2 UTSW 18 58,052,608 (GRCm39) missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 58,037,450 (GRCm39) missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 58,054,882 (GRCm39) missense probably benign 0.00
R1112:Slc12a2 UTSW 18 58,070,824 (GRCm39) missense probably benign 0.01
R1544:Slc12a2 UTSW 18 58,012,374 (GRCm39) missense probably benign 0.00
R1669:Slc12a2 UTSW 18 58,037,307 (GRCm39) missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 58,037,425 (GRCm39) missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 58,012,467 (GRCm39) missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 58,043,358 (GRCm39) missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 58,033,122 (GRCm39) missense probably benign 0.03
R3971:Slc12a2 UTSW 18 58,063,268 (GRCm39) missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 58,032,427 (GRCm39) missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 58,043,328 (GRCm39) missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 58,046,037 (GRCm39) splice site probably null
R4678:Slc12a2 UTSW 18 58,039,032 (GRCm39) nonsense probably null
R4931:Slc12a2 UTSW 18 58,068,035 (GRCm39) missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 58,032,344 (GRCm39) missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 58,012,092 (GRCm39) missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 58,029,382 (GRCm39) missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 58,029,426 (GRCm39) missense probably benign 0.01
R5789:Slc12a2 UTSW 18 58,045,091 (GRCm39) splice site probably null
R5868:Slc12a2 UTSW 18 58,077,068 (GRCm39) missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 58,065,595 (GRCm39) missense probably benign 0.06
R6126:Slc12a2 UTSW 18 58,077,116 (GRCm39) missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 58,048,578 (GRCm39) missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 58,031,145 (GRCm39) missense probably benign 0.01
R6615:Slc12a2 UTSW 18 58,031,200 (GRCm39) missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 58,052,541 (GRCm39) missense probably benign 0.05
R6957:Slc12a2 UTSW 18 58,043,344 (GRCm39) nonsense probably null
R7411:Slc12a2 UTSW 18 58,074,085 (GRCm39) missense probably benign 0.01
R7508:Slc12a2 UTSW 18 58,037,465 (GRCm39) missense probably benign 0.01
R7645:Slc12a2 UTSW 18 58,029,450 (GRCm39) missense possibly damaging 0.94
R7658:Slc12a2 UTSW 18 58,065,596 (GRCm39) missense probably benign 0.02
R8054:Slc12a2 UTSW 18 58,054,944 (GRCm39) nonsense probably null
R8093:Slc12a2 UTSW 18 58,012,423 (GRCm39) missense probably benign 0.17
R8099:Slc12a2 UTSW 18 58,032,464 (GRCm39) missense probably damaging 0.99
R8121:Slc12a2 UTSW 18 58,032,403 (GRCm39) missense probably benign 0.44
R8214:Slc12a2 UTSW 18 58,070,791 (GRCm39) missense probably benign 0.29
R8273:Slc12a2 UTSW 18 58,047,338 (GRCm39) splice site probably benign
R8341:Slc12a2 UTSW 18 58,012,281 (GRCm39) missense possibly damaging 0.48
R8485:Slc12a2 UTSW 18 58,074,218 (GRCm39) critical splice donor site probably null
R8797:Slc12a2 UTSW 18 58,012,455 (GRCm39) missense possibly damaging 0.80
R9049:Slc12a2 UTSW 18 58,054,863 (GRCm39) nonsense probably null
R9180:Slc12a2 UTSW 18 58,069,469 (GRCm39) missense possibly damaging 0.83
R9256:Slc12a2 UTSW 18 58,074,867 (GRCm39) missense probably damaging 1.00
R9337:Slc12a2 UTSW 18 58,063,238 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGGGATTAGGACCTAACATGATTCA -3'
(R):5'- AGGCACAACTTTCTAACCAAGTAACTCG -3'

Sequencing Primer
(F):5'- AGGACCTAACATGATTCATCTCTC -3'
(R):5'- gaagaacaagaagaaccaaccag -3'
Posted On 2013-04-16