Incidental Mutation 'R0194:Ppargc1b'
ID 23337
Institutional Source Beutler Lab
Gene Symbol Ppargc1b
Ensembl Gene ENSMUSG00000033871
Gene Name peroxisome proliferative activated receptor, gamma, coactivator 1 beta
Synonyms PGC-1beta/ERRL1, 4631412G21Rik
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R0194 (G1)
Quality Score 180
Status Validated
Chromosome 18
Chromosomal Location 61298136-61400431 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 61307945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 634 (L634R)
Ref Sequence ENSEMBL: ENSMUSP00000069431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]
AlphaFold Q8VHJ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000063307
AA Change: L634R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: L634R

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
low complexity region 169 189 N/A INTRINSIC
coiled coil region 437 472 N/A INTRINSIC
low complexity region 613 619 N/A INTRINSIC
low complexity region 640 656 N/A INTRINSIC
low complexity region 799 833 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
RRM 910 980 8.87e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075299
AA Change: L618R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: L618R

DomainStartEndE-ValueType
low complexity region 91 96 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 153 173 N/A INTRINSIC
coiled coil region 421 456 N/A INTRINSIC
low complexity region 597 603 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 783 817 N/A INTRINSIC
low complexity region 836 856 N/A INTRINSIC
RRM 894 964 8.87e-7 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Ppargc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ppargc1b APN 18 61323164 missense probably damaging 1.00
IGL02160:Ppargc1b APN 18 61310435 missense probably damaging 1.00
IGL02176:Ppargc1b APN 18 61310875 nonsense probably null
IGL02176:Ppargc1b APN 18 61310874 missense probably damaging 1.00
IGL02183:Ppargc1b APN 18 61309096 critical splice acceptor site probably null
IGL02386:Ppargc1b APN 18 61323151 missense probably damaging 1.00
IGL02620:Ppargc1b APN 18 61298739 missense probably damaging 1.00
IGL02688:Ppargc1b APN 18 61312243 missense possibly damaging 0.94
IGL02801:Ppargc1b APN 18 61307684 missense possibly damaging 0.77
IGL02970:Ppargc1b APN 18 61298766 missense probably damaging 1.00
R0033:Ppargc1b UTSW 18 61307694 missense probably damaging 1.00
R0139:Ppargc1b UTSW 18 61315963 splice site probably benign
R0412:Ppargc1b UTSW 18 61315861 missense probably damaging 0.99
R0574:Ppargc1b UTSW 18 61302739 missense probably benign 0.34
R0576:Ppargc1b UTSW 18 61311441 missense probably damaging 0.98
R1546:Ppargc1b UTSW 18 61310606 missense probably damaging 1.00
R1721:Ppargc1b UTSW 18 61307204 splice site probably null
R1758:Ppargc1b UTSW 18 61298786 splice site probably null
R1951:Ppargc1b UTSW 18 61298777 missense possibly damaging 0.55
R2110:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2112:Ppargc1b UTSW 18 61311250 missense probably benign 0.00
R2212:Ppargc1b UTSW 18 61311220 nonsense probably null
R2432:Ppargc1b UTSW 18 61307799 missense possibly damaging 0.93
R3612:Ppargc1b UTSW 18 61310556 missense probably benign 0.07
R3848:Ppargc1b UTSW 18 61311042 missense probably damaging 1.00
R3913:Ppargc1b UTSW 18 61311376 missense probably damaging 0.99
R4328:Ppargc1b UTSW 18 61382469 nonsense probably null
R4502:Ppargc1b UTSW 18 61302679 missense probably benign 0.39
R4762:Ppargc1b UTSW 18 61311257 missense possibly damaging 0.93
R5032:Ppargc1b UTSW 18 61307265 missense probably damaging 1.00
R5111:Ppargc1b UTSW 18 61310487 missense probably damaging 1.00
R5119:Ppargc1b UTSW 18 61307654 missense probably benign 0.38
R5164:Ppargc1b UTSW 18 61302644 missense probably damaging 1.00
R5266:Ppargc1b UTSW 18 61315805 missense probably damaging 1.00
R5350:Ppargc1b UTSW 18 61309063 missense possibly damaging 0.78
R5478:Ppargc1b UTSW 18 61307568 missense probably benign
R5719:Ppargc1b UTSW 18 61307568 missense probably benign
R5876:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5877:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5879:Ppargc1b UTSW 18 61309093 missense probably damaging 0.99
R5967:Ppargc1b UTSW 18 61298766 missense probably damaging 1.00
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6030:Ppargc1b UTSW 18 61307934 nonsense probably null
R6135:Ppargc1b UTSW 18 61315909 missense probably damaging 0.99
R6533:Ppargc1b UTSW 18 61307774 missense possibly damaging 0.93
R6791:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R6792:Ppargc1b UTSW 18 61307676 missense probably damaging 1.00
R7033:Ppargc1b UTSW 18 61307714 missense probably damaging 0.96
R7316:Ppargc1b UTSW 18 61307838 missense probably damaging 0.97
R7560:Ppargc1b UTSW 18 61312210 missense probably damaging 1.00
R8007:Ppargc1b UTSW 18 61310494 missense possibly damaging 0.55
R8374:Ppargc1b UTSW 18 61310493 missense probably damaging 0.99
R9072:Ppargc1b UTSW 18 61310659 missense probably damaging 1.00
R9073:Ppargc1b UTSW 18 61310659 missense probably damaging 1.00
R9178:Ppargc1b UTSW 18 61310922 missense probably benign 0.06
R9339:Ppargc1b UTSW 18 61323196 missense probably damaging 1.00
R9357:Ppargc1b UTSW 18 61315868 missense probably damaging 0.99
R9406:Ppargc1b UTSW 18 61310980 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGTCGTGGTCTCCAAAGGAGCAG -3'
(R):5'- CCAGTTAGTGATTCGAAGCCACCC -3'

Sequencing Primer
(F):5'- TCTCCAAAGGAGCAGGAGAAG -3'
(R):5'- CCACCTATAAGGGATCTTGTGAC -3'
Posted On 2013-04-16