Mutagenetix > Incidental Mutation

Incidental Mutation 'R0194:Ppargc1b'

23337

Institutional Source

Beutler Lab

Gene Symbol

Ppargc1b

Ensembl Gene

ENSMUSG00000033871

Gene Name

peroxisome proliferative activated receptor, gamma, coactivator 1 beta

Synonyms

PGC-1beta/ERRL1, 4631412G21Rik

MMRRC Submission

038453-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.399) question?

Stock #

R0194 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

61298136-61400431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 61307945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 634 (L634R)

Ref Sequence

ENSEMBL: ENSMUSP00000069431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]

AlphaFold

Q8VHJ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063307
AA Change: L634R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: L634R

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	107	112	N/A	INTRINSIC
low complexity region	137	156	N/A	INTRINSIC
low complexity region	169	189	N/A	INTRINSIC
coiled coil region	437	472	N/A	INTRINSIC
low complexity region	613	619	N/A	INTRINSIC
low complexity region	640	656	N/A	INTRINSIC
low complexity region	799	833	N/A	INTRINSIC
low complexity region	852	872	N/A	INTRINSIC
RRM	910	980	8.87e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075299
AA Change: L618R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: L618R

Domain	Start	End	E-Value	Type
low complexity region	91	96	N/A	INTRINSIC
low complexity region	121	140	N/A	INTRINSIC
low complexity region	153	173	N/A	INTRINSIC
coiled coil region	421	456	N/A	INTRINSIC
low complexity region	597	603	N/A	INTRINSIC
low complexity region	624	640	N/A	INTRINSIC
low complexity region	783	817	N/A	INTRINSIC
low complexity region	836	856	N/A	INTRINSIC
RRM	894	964	8.87e-7	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 91.4%
20x: 70.1%

Validation Efficiency

91% (439/482)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	T	A	4: 35,197,207	D122V	probably damaging	Het
4930553M12Rik	T	A	4: 88,868,243	D46V	unknown	Het
Abcb9	A	G	5: 124,077,295	V461A	probably damaging	Het
Ackr4	T	A	9: 104,099,480	L89F	probably benign	Het
Acsf2	T	C	11: 94,561,370	T449A	probably benign	Het
Acsl4	C	G	X: 142,333,718	G489R	probably damaging	Het
Actl6a	T	A	3: 32,725,320	I399N	probably damaging	Het
Adamts19	G	A	18: 59,011,148	C934Y	probably null	Het
Adsl	A	G	15: 80,961,360	E40G	possibly damaging	Het
AI481877	T	A	4: 59,066,534		probably benign	Het
Alppl2	T	G	1: 87,088,743	D203A	probably damaging	Het
Asb10	C	A	5: 24,537,932	A268S	probably benign	Het
Atp9a	T	C	2: 168,643,885	S832G	probably benign	Het
Bckdha	A	T	7: 25,631,450	I297N	probably damaging	Het
Blm	G	A	7: 80,464,946		probably benign	Het
Cacna1h	A	G	17: 25,380,924		probably benign	Het
Camsap2	G	A	1: 136,292,948	Q298*	probably null	Het
Ccdc38	A	T	10: 93,565,912	K145*	probably null	Het
Cfap45	C	T	1: 172,541,327	T434M	probably benign	Het
Cfap54	A	T	10: 93,034,662		probably benign	Het
Clcn6	G	A	4: 148,012,756	P618L	probably damaging	Het
Copg1	T	C	6: 87,904,197		probably benign	Het
Dctd	T	A	8: 48,112,078	N79K	probably benign	Het
Dgkq	A	G	5: 108,654,644		probably benign	Het
Dntt	A	T	19: 41,038,970	T159S	possibly damaging	Het
Doc2g	G	A	19: 4,003,656	R29Q	probably benign	Het
Dsg3	A	G	18: 20,540,142	T957A	probably damaging	Het
Eif3c	T	A	7: 126,558,623		probably benign	Het
Ephb3	T	A	16: 21,218,109	D107E	probably benign	Het
Esrrb	A	T	12: 86,470,481	D108V	probably damaging	Het
Exo1	A	G	1: 175,892,030	K214E	probably damaging	Het
Fam186a	G	A	15: 99,941,763	T2200I	possibly damaging	Het
Fam227a	C	T	15: 79,640,669	W194*	probably null	Het
Foxn4	A	G	5: 114,259,748		probably null	Het
Gabbr2	T	C	4: 46,787,565	K366R	possibly damaging	Het
Garem2	T	A	5: 30,113,930	V130E	probably damaging	Het
Grin2b	A	G	6: 135,779,305	F474S	probably damaging	Het
H2-M10.6	G	T	17: 36,814,042	V284F	probably damaging	Het
Helz2	C	A	2: 181,232,759	G1981C	probably damaging	Het
Hivep1	G	T	13: 42,155,435	V384F	probably damaging	Het
Hmox1	A	G	8: 75,097,108	T135A	probably damaging	Het
Hpse	T	C	5: 100,719,512	D28G	probably benign	Het
Itm2b	G	T	14: 73,364,618	D213E	probably benign	Het
Jakmip1	T	A	5: 37,134,283	M692K	possibly damaging	Het
Kdm3a	T	C	6: 71,624,594	Q151R	probably null	Het
Limch1	C	A	5: 66,999,273	A517E	probably benign	Het
Lrit1	T	A	14: 37,061,720	L335Q	probably damaging	Het
Lrrc37a	A	G	11: 103,499,790	V1603A	possibly damaging	Het
Mbtps1	T	A	8: 119,535,369	N347I	probably damaging	Het
Mier1	A	T	4: 103,139,519		probably null	Het
Mt2	A	T	8: 94,172,848	M1L	probably damaging	Het
Mug1	A	T	6: 121,840,107	E45V	probably damaging	Het
Mybphl	A	G	3: 108,374,168	K67E	probably benign	Het
Myh4	A	G	11: 67,252,336	K1030R	probably damaging	Het
Myl3	T	A	9: 110,769,121	D176E	probably benign	Het
Ncapg2	A	G	12: 116,420,683		probably null	Het
Ndor1	T	C	2: 25,248,706		probably null	Het
Nedd4	T	G	9: 72,670,053	N53K	possibly damaging	Het
Nek11	C	A	9: 105,392,952	A24S	probably benign	Het
Nudt19	G	T	7: 35,551,514	P267T	probably benign	Het
Olfml2b	T	C	1: 170,681,115	M514T	possibly damaging	Het
Olfr304	A	T	7: 86,386,374	C95*	probably null	Het
Olfr424	A	T	1: 174,136,761	T6S	probably benign	Het
Olfr556	A	G	7: 102,670,199	D93G	probably benign	Het
Olfr699	C	A	7: 106,790,823	M59I	probably benign	Het
P3h1	T	A	4: 119,237,952	F302Y	probably damaging	Het
Pappa2	T	A	1: 158,765,101		probably benign	Het
Pex2	A	C	3: 5,561,364	H128Q	probably benign	Het
Phf11d	A	C	14: 59,352,731	L214R	probably damaging	Het
Plcg2	G	A	8: 117,573,397		probably benign	Het
Prune1	A	T	3: 95,262,360	I177N	probably damaging	Het
Puf60	T	C	15: 76,070,485	D496G	probably damaging	Het
Rasl11b	A	G	5: 74,196,163		probably null	Het
Sdr42e1	A	T	8: 117,663,109	F264L	probably damaging	Het
Sec24b	A	T	3: 129,984,165		probably null	Het
Sgta	G	T	10: 81,051,059	P79T	probably benign	Het
Shisa9	C	T	16: 11,984,954	T125M	probably damaging	Het
Slc12a2	A	G	18: 57,930,211	D921G	probably damaging	Het
Slc13a5	C	T	11: 72,245,233	V494I	probably benign	Het
Slc13a5	T	A	11: 72,262,130	I42L	possibly damaging	Het
Spire2	G	A	8: 123,363,011		probably benign	Het
Sptbn4	G	A	7: 27,404,911	R962C	probably benign	Het
St8sia5	G	A	18: 77,254,724	V377I	probably benign	Het
Stag2	T	G	X: 42,206,137		probably benign	Het
Syne1	C	A	10: 5,424,311	M165I	probably benign	Het
Synm	C	A	7: 67,734,924	V997L	probably damaging	Het
Tacc1	A	G	8: 25,182,376	S279P	probably benign	Het
Tbc1d10a	T	C	11: 4,212,901		probably null	Het
Tbc1d19	A	G	5: 53,860,156	T302A	probably damaging	Het
Tecpr1	A	C	5: 144,218,517	N74K	probably damaging	Het
Tmem120a	T	C	5: 135,742,398	E28G	possibly damaging	Het
Tnfrsf1b	A	T	4: 145,224,812	I186N	probably benign	Het
Trim55	A	G	3: 19,661,861	D195G	probably benign	Het
Trpm3	G	T	19: 22,715,356		probably null	Het
Ttc39a	T	A	4: 109,444,179	S571T	probably benign	Het
Vwf	T	G	6: 125,643,297	I1646S	probably benign	Het
Wbp2nl	T	C	15: 82,314,282	F340S	possibly damaging	Het
Yeats2	T	C	16: 20,152,969	M1T	probably null	Het
Zfp236	T	A	18: 82,656,987	E460V	probably damaging	Het
Zfp277	G	A	12: 40,378,877		probably benign	Het
Zfp975	T	A	7: 42,662,492	K232N	probably benign	Het
Zxdc	T	C	6: 90,372,537		probably benign	Het

Other mutations in Ppargc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Ppargc1b	APN	18	61323164	missense	probably damaging	1.00
IGL02160:Ppargc1b	APN	18	61310435	missense	probably damaging	1.00
IGL02176:Ppargc1b	APN	18	61310875	nonsense	probably null
IGL02176:Ppargc1b	APN	18	61310874	missense	probably damaging	1.00
IGL02183:Ppargc1b	APN	18	61309096	critical splice acceptor site	probably null
IGL02386:Ppargc1b	APN	18	61323151	missense	probably damaging	1.00
IGL02620:Ppargc1b	APN	18	61298739	missense	probably damaging	1.00
IGL02688:Ppargc1b	APN	18	61312243	missense	possibly damaging	0.94
IGL02801:Ppargc1b	APN	18	61307684	missense	possibly damaging	0.77
IGL02970:Ppargc1b	APN	18	61298766	missense	probably damaging	1.00
R0033:Ppargc1b	UTSW	18	61307694	missense	probably damaging	1.00
R0139:Ppargc1b	UTSW	18	61315963	splice site	probably benign
R0412:Ppargc1b	UTSW	18	61315861	missense	probably damaging	0.99
R0574:Ppargc1b	UTSW	18	61302739	missense	probably benign	0.34
R0576:Ppargc1b	UTSW	18	61311441	missense	probably damaging	0.98
R1546:Ppargc1b	UTSW	18	61310606	missense	probably damaging	1.00
R1721:Ppargc1b	UTSW	18	61307204	splice site	probably null
R1758:Ppargc1b	UTSW	18	61298786	splice site	probably null
R1951:Ppargc1b	UTSW	18	61298777	missense	possibly damaging	0.55
R2110:Ppargc1b	UTSW	18	61311250	missense	probably benign	0.00
R2112:Ppargc1b	UTSW	18	61311250	missense	probably benign	0.00
R2212:Ppargc1b	UTSW	18	61311220	nonsense	probably null
R2432:Ppargc1b	UTSW	18	61307799	missense	possibly damaging	0.93
R3612:Ppargc1b	UTSW	18	61310556	missense	probably benign	0.07
R3848:Ppargc1b	UTSW	18	61311042	missense	probably damaging	1.00
R3913:Ppargc1b	UTSW	18	61311376	missense	probably damaging	0.99
R4328:Ppargc1b	UTSW	18	61382469	nonsense	probably null
R4502:Ppargc1b	UTSW	18	61302679	missense	probably benign	0.39
R4762:Ppargc1b	UTSW	18	61311257	missense	possibly damaging	0.93
R5032:Ppargc1b	UTSW	18	61307265	missense	probably damaging	1.00
R5111:Ppargc1b	UTSW	18	61310487	missense	probably damaging	1.00
R5119:Ppargc1b	UTSW	18	61307654	missense	probably benign	0.38
R5164:Ppargc1b	UTSW	18	61302644	missense	probably damaging	1.00
R5266:Ppargc1b	UTSW	18	61315805	missense	probably damaging	1.00
R5350:Ppargc1b	UTSW	18	61309063	missense	possibly damaging	0.78
R5478:Ppargc1b	UTSW	18	61307568	missense	probably benign
R5719:Ppargc1b	UTSW	18	61307568	missense	probably benign
R5876:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5877:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5879:Ppargc1b	UTSW	18	61309093	missense	probably damaging	0.99
R5967:Ppargc1b	UTSW	18	61298766	missense	probably damaging	1.00
R6030:Ppargc1b	UTSW	18	61307934	nonsense	probably null
R6030:Ppargc1b	UTSW	18	61307934	nonsense	probably null
R6135:Ppargc1b	UTSW	18	61315909	missense	probably damaging	0.99
R6533:Ppargc1b	UTSW	18	61307774	missense	possibly damaging	0.93
R6791:Ppargc1b	UTSW	18	61307676	missense	probably damaging	1.00
R6792:Ppargc1b	UTSW	18	61307676	missense	probably damaging	1.00
R7033:Ppargc1b	UTSW	18	61307714	missense	probably damaging	0.96
R7316:Ppargc1b	UTSW	18	61307838	missense	probably damaging	0.97
R7560:Ppargc1b	UTSW	18	61312210	missense	probably damaging	1.00
R8007:Ppargc1b	UTSW	18	61310494	missense	possibly damaging	0.55
R8374:Ppargc1b	UTSW	18	61310493	missense	probably damaging	0.99
R9072:Ppargc1b	UTSW	18	61310659	missense	probably damaging	1.00
R9073:Ppargc1b	UTSW	18	61310659	missense	probably damaging	1.00
R9178:Ppargc1b	UTSW	18	61310922	missense	probably benign	0.06
R9339:Ppargc1b	UTSW	18	61323196	missense	probably damaging	1.00
R9357:Ppargc1b	UTSW	18	61315868	missense	probably damaging	0.99
R9406:Ppargc1b	UTSW	18	61310980	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- TAGTCGTGGTCTCCAAAGGAGCAG -3'
(R):5'- CCAGTTAGTGATTCGAAGCCACCC -3'

Sequencing Primer
(F):5'- TCTCCAAAGGAGCAGGAGAAG -3'
(R):5'- CCACCTATAAGGGATCTTGTGAC -3'

Posted On

2013-04-16