Incidental Mutation 'R2132:Fcgbpl1'
ID 233388
Institutional Source Beutler Lab
Gene Symbol Fcgbpl1
Ensembl Gene ENSMUSG00000078776
Gene Name Fc fragment of IgG binding protein like 1
Synonyms 9530053A07Rik
MMRRC Submission 040135-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R2132 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27828891-27864236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27854899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1842 (P1842S)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: P1842S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: P1842S

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: P1842S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: P1842S

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (117/124)
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 88,112,335 (GRCm39) probably benign Het
4930562C15Rik A C 16: 4,653,835 (GRCm39) Q128P unknown Het
Abcc3 T A 11: 94,258,426 (GRCm39) K473M probably benign Het
Acacb TGGGG TGGG 5: 114,347,828 (GRCm39) probably null Het
Adgrg7 C A 16: 56,588,281 (GRCm39) A199S probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Ap2b1 T A 11: 83,215,587 (GRCm39) probably benign Het
Atat1 A G 17: 36,220,331 (GRCm39) S54P probably damaging Het
Atp13a2 T A 4: 140,732,327 (GRCm39) M864K probably damaging Het
B3gnt3 G A 8: 72,145,971 (GRCm39) T186M probably damaging Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc157 A T 11: 4,100,004 (GRCm39) V116E probably damaging Het
Ccdc85a G A 11: 28,384,151 (GRCm39) T408I probably benign Het
Celf1 G T 2: 90,840,791 (GRCm39) G353W probably damaging Het
Celsr1 T A 15: 85,916,168 (GRCm39) I602F possibly damaging Het
Cenpb C T 2: 131,021,226 (GRCm39) V191M probably damaging Het
Cenpn G A 8: 117,661,536 (GRCm39) probably null Het
Cfap65 A C 1: 74,946,850 (GRCm39) C1287G probably damaging Het
Cmya5 G A 13: 93,205,891 (GRCm39) T3326I probably damaging Het
Cnn3 A T 3: 121,245,584 (GRCm39) E100V probably damaging Het
Col4a4 G A 1: 82,475,581 (GRCm39) R583C unknown Het
Commd7 A C 2: 153,463,586 (GRCm39) probably benign Het
Csmd3 T C 15: 48,320,899 (GRCm39) T304A probably benign Het
Cyp4a14 A T 4: 115,348,588 (GRCm39) S325R probably damaging Het
Dclk2 T C 3: 86,827,353 (GRCm39) N42S probably benign Het
Dmrta1 A T 4: 89,576,946 (GRCm39) Q134L probably damaging Het
Dnaaf3 T A 7: 4,526,800 (GRCm39) I426L probably benign Het
Dnah17 G A 11: 117,924,573 (GRCm39) L3999F probably damaging Het
Dock6 A G 9: 21,757,814 (GRCm39) S97P probably benign Het
Dsg1a T A 18: 20,473,854 (GRCm39) S976T probably damaging Het
Dstyk T A 1: 132,377,222 (GRCm39) M29K probably null Het
Eif3i A T 4: 129,490,719 (GRCm39) H18Q probably benign Het
Epm2a A G 10: 11,219,426 (GRCm39) E71G probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Faf1 A G 4: 109,568,042 (GRCm39) N34S probably damaging Het
Fat3 A G 9: 16,158,015 (GRCm39) probably null Het
Fbxw10 T A 11: 62,750,683 (GRCm39) I422N probably damaging Het
Fkbp15 C A 4: 62,246,136 (GRCm39) G431W probably damaging Het
Flnb A C 14: 7,873,376 (GRCm38) D224A probably benign Het
Flnc G A 6: 29,443,675 (GRCm39) V566M probably damaging Het
Gli3 T A 13: 15,900,134 (GRCm39) S1174T possibly damaging Het
Glmn A T 5: 107,726,321 (GRCm39) V93E probably damaging Het
Glrx2 T C 1: 143,620,842 (GRCm39) S74P possibly damaging Het
Gm5422 G A 10: 31,124,929 (GRCm39) noncoding transcript Het
Gpi1 T C 7: 33,905,339 (GRCm39) K362E probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Gxylt1 A G 15: 93,142,851 (GRCm39) *405R probably null Het
Heyl T C 4: 123,139,876 (GRCm39) V145A probably damaging Het
Hhipl1 A C 12: 108,277,949 (GRCm39) E92D probably damaging Het
Ifi207 A G 1: 173,557,337 (GRCm39) F467S possibly damaging Het
Ift70b G T 2: 75,767,129 (GRCm39) H541Q probably damaging Het
Igf2r A T 17: 12,941,095 (GRCm39) I462N probably benign Het
Inpp5b A T 4: 124,678,961 (GRCm39) probably benign Het
Kansl2 A G 15: 98,427,278 (GRCm39) I201T probably damaging Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kcnu1 T A 8: 26,341,928 (GRCm39) I91N probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Klrc3 T A 6: 129,618,501 (GRCm39) Y94F probably benign Het
Lgals3bp T A 11: 118,284,113 (GRCm39) T489S probably benign Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Magi1 T C 6: 93,674,255 (GRCm39) E951G probably damaging Het
Mcm7 T C 5: 138,167,364 (GRCm39) Q86R probably damaging Het
Med12l G T 3: 59,172,703 (GRCm39) probably null Het
Morc2a A G 11: 3,629,787 (GRCm39) E402G possibly damaging Het
Mphosph8 T C 14: 56,916,161 (GRCm39) C486R probably benign Het
Mpo A G 11: 87,688,187 (GRCm39) D282G possibly damaging Het
Mtcl1 G T 17: 66,650,618 (GRCm39) H1616N probably benign Het
Myh10 A G 11: 68,698,115 (GRCm39) probably benign Het
Myh8 A G 11: 67,183,702 (GRCm39) E777G probably damaging Het
Nid1 A G 13: 13,684,071 (GRCm39) H1186R probably benign Het
Nppb T A 4: 148,070,454 (GRCm39) S8T probably benign Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1ak2 A G 2: 36,827,704 (GRCm39) N191S probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or5al5 A G 2: 85,961,605 (GRCm39) V134A possibly damaging Het
Or5b99 T A 19: 12,976,402 (GRCm39) D17E probably benign Het
Or6f1 C T 7: 85,970,687 (GRCm39) V158M possibly damaging Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pate6 T G 9: 35,701,039 (GRCm39) probably benign Het
Pdlim4 A G 11: 53,954,563 (GRCm39) L48S possibly damaging Het
Phactr3 T C 2: 177,925,759 (GRCm39) F345L probably benign Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Prcp T A 7: 92,550,488 (GRCm39) V95D probably benign Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Ror1 A G 4: 100,267,222 (GRCm39) N308D probably benign Het
Sdccag8 C A 1: 176,783,455 (GRCm39) Q655K probably damaging Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Skap1 T C 11: 96,355,559 (GRCm39) I10T possibly damaging Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Smad2 T A 18: 76,421,155 (GRCm39) C161* probably null Het
Spata31d1a G T 13: 59,848,857 (GRCm39) D1090E probably damaging Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Terf1 A G 1: 15,875,909 (GRCm39) E3G probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tnfrsf26 C T 7: 143,171,577 (GRCm39) probably null Het
Tor1aip1 A C 1: 155,883,308 (GRCm39) M180R probably damaging Het
Trabd2b A T 4: 114,467,205 (GRCm39) Q478L probably benign Het
Trim41 C A 11: 48,698,419 (GRCm39) G516W probably damaging Het
Ttc39a A G 4: 109,299,903 (GRCm39) Y464C probably damaging Het
Unc5a A G 13: 55,138,896 (GRCm39) S92G probably damaging Het
Unc5d A C 8: 29,365,557 (GRCm39) S143A possibly damaging Het
Usp34 A T 11: 23,414,556 (GRCm39) H2833L possibly damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Wdr17 T G 8: 55,125,541 (GRCm39) K446N probably damaging Het
Xirp2 A T 2: 67,338,392 (GRCm39) Q211L possibly damaging Het
Xkr7 G A 2: 152,894,816 (GRCm39) R256Q probably benign Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp268 T A 4: 145,350,803 (GRCm39) probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp747l1 T C 7: 126,986,107 (GRCm39) D8G probably benign Het
Zfp758 A G 17: 22,594,951 (GRCm39) H479R probably damaging Het
Zfp827 A G 8: 79,912,350 (GRCm39) N284S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Fcgbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fcgbpl1 APN 7 27,863,953 (GRCm39) missense probably damaging 1.00
IGL00757:Fcgbpl1 APN 7 27,853,870 (GRCm39) missense probably damaging 1.00
IGL01015:Fcgbpl1 APN 7 27,854,743 (GRCm39) missense probably damaging 1.00
IGL01079:Fcgbpl1 APN 7 27,839,203 (GRCm39) missense probably damaging 0.99
IGL01343:Fcgbpl1 APN 7 27,850,127 (GRCm39) missense probably benign 0.19
IGL01420:Fcgbpl1 APN 7 27,839,558 (GRCm39) missense probably benign 0.28
IGL01604:Fcgbpl1 APN 7 27,854,749 (GRCm39) missense probably benign 0.11
IGL01666:Fcgbpl1 APN 7 27,852,717 (GRCm39) missense probably damaging 1.00
IGL02002:Fcgbpl1 APN 7 27,852,221 (GRCm39) missense probably damaging 1.00
IGL02036:Fcgbpl1 APN 7 27,836,950 (GRCm39) missense possibly damaging 0.82
IGL02126:Fcgbpl1 APN 7 27,839,281 (GRCm39) missense probably damaging 1.00
IGL02150:Fcgbpl1 APN 7 27,846,204 (GRCm39) nonsense probably null
IGL02219:Fcgbpl1 APN 7 27,854,060 (GRCm39) missense probably damaging 1.00
IGL02563:Fcgbpl1 APN 7 27,857,317 (GRCm39) missense probably benign
IGL02804:Fcgbpl1 APN 7 27,852,795 (GRCm39) missense probably benign 0.00
IGL02830:Fcgbpl1 APN 7 27,862,348 (GRCm39) missense probably damaging 1.00
IGL02943:Fcgbpl1 APN 7 27,846,613 (GRCm39) missense probably damaging 1.00
IGL02977:Fcgbpl1 APN 7 27,863,797 (GRCm39) missense possibly damaging 0.83
IGL03231:Fcgbpl1 APN 7 27,853,147 (GRCm39) missense possibly damaging 0.95
IGL03304:Fcgbpl1 APN 7 27,841,667 (GRCm39) missense probably damaging 0.99
herz UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
pulse UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
Sinusoidal UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
PIT4378001:Fcgbpl1 UTSW 7 27,853,889 (GRCm39) missense possibly damaging 0.61
R0023:Fcgbpl1 UTSW 7 27,852,837 (GRCm39) missense probably benign 0.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0132:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0158:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R0230:Fcgbpl1 UTSW 7 27,856,250 (GRCm39) missense probably damaging 1.00
R0310:Fcgbpl1 UTSW 7 27,841,699 (GRCm39) missense probably benign 0.04
R0448:Fcgbpl1 UTSW 7 27,839,660 (GRCm39) missense probably benign 0.03
R0462:Fcgbpl1 UTSW 7 27,836,765 (GRCm39) missense probably damaging 1.00
R0481:Fcgbpl1 UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
R0497:Fcgbpl1 UTSW 7 27,846,890 (GRCm39) missense probably damaging 1.00
R0556:Fcgbpl1 UTSW 7 27,858,803 (GRCm39) missense probably benign
R0562:Fcgbpl1 UTSW 7 27,862,115 (GRCm39) missense probably benign 0.30
R0586:Fcgbpl1 UTSW 7 27,836,516 (GRCm39) missense probably damaging 0.99
R0924:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R0930:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R1103:Fcgbpl1 UTSW 7 27,853,945 (GRCm39) missense probably damaging 1.00
R1213:Fcgbpl1 UTSW 7 27,857,098 (GRCm39) missense probably damaging 1.00
R1292:Fcgbpl1 UTSW 7 27,842,219 (GRCm39) splice site probably benign
R1368:Fcgbpl1 UTSW 7 27,858,903 (GRCm39) missense possibly damaging 0.89
R1451:Fcgbpl1 UTSW 7 27,836,582 (GRCm39) missense probably damaging 1.00
R1477:Fcgbpl1 UTSW 7 27,856,518 (GRCm39) missense probably benign 0.01
R1538:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R1655:Fcgbpl1 UTSW 7 27,846,535 (GRCm39) missense probably damaging 0.98
R1697:Fcgbpl1 UTSW 7 27,853,772 (GRCm39) missense probably damaging 1.00
R1741:Fcgbpl1 UTSW 7 27,857,279 (GRCm39) missense probably damaging 0.98
R1796:Fcgbpl1 UTSW 7 27,854,797 (GRCm39) missense probably damaging 1.00
R1853:Fcgbpl1 UTSW 7 27,854,971 (GRCm39) nonsense probably null
R1861:Fcgbpl1 UTSW 7 27,854,157 (GRCm39) missense probably damaging 1.00
R1909:Fcgbpl1 UTSW 7 27,843,773 (GRCm39) missense possibly damaging 0.52
R1971:Fcgbpl1 UTSW 7 27,830,937 (GRCm39) missense possibly damaging 0.90
R1990:Fcgbpl1 UTSW 7 27,853,785 (GRCm39) missense probably damaging 0.98
R2020:Fcgbpl1 UTSW 7 27,855,019 (GRCm39) missense probably benign
R2084:Fcgbpl1 UTSW 7 27,856,960 (GRCm39) missense probably damaging 1.00
R2125:Fcgbpl1 UTSW 7 27,857,447 (GRCm39) missense probably benign 0.00
R2513:Fcgbpl1 UTSW 7 27,831,060 (GRCm39) missense probably damaging 0.99
R2913:Fcgbpl1 UTSW 7 27,863,732 (GRCm39) missense probably damaging 1.00
R3150:Fcgbpl1 UTSW 7 27,853,620 (GRCm39) missense probably benign 0.21
R3499:Fcgbpl1 UTSW 7 27,853,980 (GRCm39) missense probably benign 0.42
R3702:Fcgbpl1 UTSW 7 27,857,203 (GRCm39) missense probably damaging 1.00
R3881:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R3938:Fcgbpl1 UTSW 7 27,853,719 (GRCm39) missense probably damaging 1.00
R4050:Fcgbpl1 UTSW 7 27,852,410 (GRCm39) missense possibly damaging 0.55
R4152:Fcgbpl1 UTSW 7 27,856,322 (GRCm39) missense possibly damaging 0.47
R4168:Fcgbpl1 UTSW 7 27,836,534 (GRCm39) missense probably benign 0.05
R4235:Fcgbpl1 UTSW 7 27,856,073 (GRCm39) missense probably damaging 0.99
R4241:Fcgbpl1 UTSW 7 27,853,760 (GRCm39) missense probably damaging 1.00
R4363:Fcgbpl1 UTSW 7 27,846,331 (GRCm39) missense probably damaging 1.00
R4460:Fcgbpl1 UTSW 7 27,852,281 (GRCm39) missense probably benign 0.17
R4463:Fcgbpl1 UTSW 7 27,850,144 (GRCm39) missense probably benign
R4841:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4842:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4876:Fcgbpl1 UTSW 7 27,842,225 (GRCm39) intron probably benign
R4905:Fcgbpl1 UTSW 7 27,856,408 (GRCm39) missense possibly damaging 0.93
R4997:Fcgbpl1 UTSW 7 27,843,349 (GRCm39) missense possibly damaging 0.77
R5091:Fcgbpl1 UTSW 7 27,856,383 (GRCm39) missense probably benign 0.44
R5159:Fcgbpl1 UTSW 7 27,852,733 (GRCm39) missense probably benign 0.09
R5326:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5396:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign
R5441:Fcgbpl1 UTSW 7 27,856,339 (GRCm39) missense probably damaging 1.00
R5480:Fcgbpl1 UTSW 7 27,857,424 (GRCm39) nonsense probably null
R5542:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5571:Fcgbpl1 UTSW 7 27,855,994 (GRCm39) missense probably damaging 0.99
R5613:Fcgbpl1 UTSW 7 27,842,303 (GRCm39) intron probably benign
R5637:Fcgbpl1 UTSW 7 27,852,277 (GRCm39) missense probably benign 0.00
R5766:Fcgbpl1 UTSW 7 27,836,754 (GRCm39) nonsense probably null
R6174:Fcgbpl1 UTSW 7 27,839,384 (GRCm39) missense probably damaging 0.96
R6233:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R6250:Fcgbpl1 UTSW 7 27,850,139 (GRCm39) missense probably damaging 1.00
R6379:Fcgbpl1 UTSW 7 27,857,017 (GRCm39) missense probably damaging 1.00
R6442:Fcgbpl1 UTSW 7 27,843,611 (GRCm39) missense possibly damaging 0.88
R6478:Fcgbpl1 UTSW 7 27,854,798 (GRCm39) missense probably damaging 1.00
R6699:Fcgbpl1 UTSW 7 27,843,793 (GRCm39) missense probably damaging 1.00
R6852:Fcgbpl1 UTSW 7 27,846,560 (GRCm39) missense probably damaging 1.00
R6883:Fcgbpl1 UTSW 7 27,852,260 (GRCm39) missense possibly damaging 0.89
R6902:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6903:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6904:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6992:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign 0.04
R7023:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R7039:Fcgbpl1 UTSW 7 27,839,573 (GRCm39) missense possibly damaging 0.80
R7171:Fcgbpl1 UTSW 7 27,853,944 (GRCm39) nonsense probably null
R7282:Fcgbpl1 UTSW 7 27,843,833 (GRCm39) missense probably benign 0.02
R7291:Fcgbpl1 UTSW 7 27,839,645 (GRCm39) missense probably benign
R7344:Fcgbpl1 UTSW 7 27,852,185 (GRCm39) missense possibly damaging 0.46
R7344:Fcgbpl1 UTSW 7 27,839,704 (GRCm39) missense possibly damaging 0.79
R7392:Fcgbpl1 UTSW 7 27,863,797 (GRCm39) missense possibly damaging 0.83
R7531:Fcgbpl1 UTSW 7 27,839,656 (GRCm39) missense probably benign
R7541:Fcgbpl1 UTSW 7 27,843,681 (GRCm39) nonsense probably null
R7577:Fcgbpl1 UTSW 7 27,853,848 (GRCm39) missense possibly damaging 0.65
R7594:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R7647:Fcgbpl1 UTSW 7 27,839,470 (GRCm39) missense probably benign 0.00
R7718:Fcgbpl1 UTSW 7 27,846,626 (GRCm39) missense probably damaging 1.00
R7733:Fcgbpl1 UTSW 7 27,839,390 (GRCm39) missense probably damaging 1.00
R7737:Fcgbpl1 UTSW 7 27,856,498 (GRCm39) missense probably damaging 1.00
R7908:Fcgbpl1 UTSW 7 27,846,921 (GRCm39) missense probably benign 0.12
R8013:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8014:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8151:Fcgbpl1 UTSW 7 27,852,766 (GRCm39) missense possibly damaging 0.95
R8175:Fcgbpl1 UTSW 7 27,863,873 (GRCm39) nonsense probably null
R8254:Fcgbpl1 UTSW 7 27,846,774 (GRCm39) missense possibly damaging 0.63
R8345:Fcgbpl1 UTSW 7 27,854,785 (GRCm39) missense probably damaging 1.00
R8414:Fcgbpl1 UTSW 7 27,842,158 (GRCm39) missense probably damaging 1.00
R8419:Fcgbpl1 UTSW 7 27,843,346 (GRCm39) missense probably damaging 1.00
R8496:Fcgbpl1 UTSW 7 27,843,377 (GRCm39) missense possibly damaging 0.81
R8691:Fcgbpl1 UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
R8785:Fcgbpl1 UTSW 7 27,854,132 (GRCm39) missense probably damaging 1.00
R8863:Fcgbpl1 UTSW 7 27,831,006 (GRCm39) missense probably damaging 1.00
R8926:Fcgbpl1 UTSW 7 27,853,869 (GRCm39) missense probably damaging 1.00
R8950:Fcgbpl1 UTSW 7 27,863,751 (GRCm39) missense probably benign 0.32
R9014:Fcgbpl1 UTSW 7 27,854,876 (GRCm39) missense probably damaging 1.00
R9045:Fcgbpl1 UTSW 7 27,853,856 (GRCm39) missense probably damaging 1.00
R9115:Fcgbpl1 UTSW 7 27,853,754 (GRCm39) missense possibly damaging 0.74
R9233:Fcgbpl1 UTSW 7 27,839,519 (GRCm39) missense possibly damaging 0.83
R9330:Fcgbpl1 UTSW 7 27,856,410 (GRCm39) missense probably benign 0.02
R9426:Fcgbpl1 UTSW 7 27,843,281 (GRCm39) missense possibly damaging 0.92
R9477:Fcgbpl1 UTSW 7 27,852,265 (GRCm39) missense probably damaging 1.00
R9502:Fcgbpl1 UTSW 7 27,836,891 (GRCm39) missense probably benign 0.09
R9505:Fcgbpl1 UTSW 7 27,841,909 (GRCm39) nonsense probably null
R9601:Fcgbpl1 UTSW 7 27,853,805 (GRCm39) missense possibly damaging 0.78
R9630:Fcgbpl1 UTSW 7 27,836,624 (GRCm39) missense probably damaging 1.00
R9632:Fcgbpl1 UTSW 7 27,841,726 (GRCm39) missense probably benign
R9673:Fcgbpl1 UTSW 7 27,856,044 (GRCm39) missense probably benign 0.25
R9735:Fcgbpl1 UTSW 7 27,856,435 (GRCm39) missense probably damaging 1.00
Z1176:Fcgbpl1 UTSW 7 27,854,187 (GRCm39) missense probably benign 0.03
Z1176:Fcgbpl1 UTSW 7 27,841,811 (GRCm39) missense probably benign 0.06
Z1177:Fcgbpl1 UTSW 7 27,839,323 (GRCm39) missense probably benign 0.25
Z1186:Fcgbpl1 UTSW 7 27,856,411 (GRCm39) missense probably benign 0.01
Z1186:Fcgbpl1 UTSW 7 27,846,130 (GRCm39) missense probably benign 0.00
Z1186:Fcgbpl1 UTSW 7 27,830,997 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCTCCCTGACTTTTGATGG -3'
(R):5'- TCCTGACATGCTGCCACATAG -3'

Sequencing Primer
(F):5'- TGGAAACAGTTTCATGCGCC -3'
(R):5'- CACATAGGTGGCTATAGCAGGAC -3'
Posted On 2014-10-01