Incidental Mutation 'R2132:9030624J02Rik'
ID233395
Institutional Source Beutler Lab
Gene Symbol 9030624J02Rik
Ensembl Gene ENSMUSG00000030982
Gene NameRIKEN cDNA 9030624J02 gene
Synonyms
MMRRC Submission 040135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2132 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118740226-118842966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118794575 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 516 (Y516H)
Ref Sequence ENSEMBL: ENSMUSP00000102163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033280] [ENSMUST00000059390] [ENSMUST00000106552] [ENSMUST00000106553]
Predicted Effect probably damaging
Transcript: ENSMUST00000033280
AA Change: Y277H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000059390
AA Change: Y540H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051263
Gene: ENSMUSG00000030982
AA Change: Y540H

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106552
AA Change: Y449H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102162
Gene: ENSMUSG00000030982
AA Change: Y449H

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106553
AA Change: Y516H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102163
Gene: ENSMUSG00000030982
AA Change: Y516H

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149749
SMART Domains Protein: ENSMUSP00000121323
Gene: ENSMUSG00000030982

DomainStartEndE-ValueType
Pfam:Vps35 2 198 7.3e-10 PFAM
Meta Mutation Damage Score 0.5831 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (117/124)
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,476 probably benign Het
4930562C15Rik A C 16: 4,835,971 Q128P unknown Het
9130019O22Rik T C 7: 127,386,935 D8G probably benign Het
9530053A07Rik C T 7: 28,155,474 P1842S probably damaging Het
Abcc3 T A 11: 94,367,600 K473M probably benign Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrg7 C A 16: 56,767,918 A199S probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Ap2b1 T A 11: 83,324,761 probably benign Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
B3gnt3 G A 8: 71,693,327 T186M probably damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc157 A T 11: 4,150,004 V116E probably damaging Het
Ccdc85a G A 11: 28,434,151 T408I probably benign Het
Celf1 G T 2: 91,010,446 G353W probably damaging Het
Celsr1 T A 15: 86,031,967 I602F possibly damaging Het
Cenpb C T 2: 131,179,306 V191M probably damaging Het
Cenpn G A 8: 116,934,797 probably null Het
Cfap65 A C 1: 74,907,691 C1287G probably damaging Het
Cmya5 G A 13: 93,069,383 T3326I probably damaging Het
Cnn3 A T 3: 121,451,935 E100V probably damaging Het
Col4a4 G A 1: 82,497,860 R583C unknown Het
Commd7 A C 2: 153,621,666 probably benign Het
Csmd3 T C 15: 48,457,503 T304A probably benign Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
D730048I06Rik T G 9: 35,789,743 probably benign Het
Dclk2 T C 3: 86,920,046 N42S probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Dnaaf3 T A 7: 4,523,801 I426L probably benign Het
Dnah17 G A 11: 118,033,747 L3999F probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Dsg1a T A 18: 20,340,797 S976T probably damaging Het
Dstyk T A 1: 132,449,484 M29K probably null Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fat3 A G 9: 16,246,719 probably null Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Flnb A C 14: 7,873,376 D224A probably benign Het
Flnc G A 6: 29,443,676 V566M probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gli3 T A 13: 15,725,549 S1174T possibly damaging Het
Glmn A T 5: 107,578,455 V93E probably damaging Het
Glrx2 T C 1: 143,745,104 S74P possibly damaging Het
Gm13212 T A 4: 145,624,233 probably benign Het
Gm5422 G A 10: 31,248,933 noncoding transcript Het
Gpi1 T C 7: 34,205,914 K362E probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Gxylt1 A G 15: 93,244,970 *405R probably null Het
Heyl T C 4: 123,246,083 V145A probably damaging Het
Hhipl1 A C 12: 108,311,690 E92D probably damaging Het
Ifi207 A G 1: 173,729,771 F467S possibly damaging Het
Igf2r A T 17: 12,722,208 I462N probably benign Het
Inpp5b A T 4: 124,785,168 probably benign Het
Kansl2 A G 15: 98,529,397 I201T probably damaging Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kcnu1 T A 8: 25,851,900 I91N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Klrc3 T A 6: 129,641,538 Y94F probably benign Het
Lgals3bp T A 11: 118,393,287 T489S probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Magi1 T C 6: 93,697,274 E951G probably damaging Het
Mcm7 T C 5: 138,169,102 Q86R probably damaging Het
Med12l G T 3: 59,265,282 probably null Het
Morc2a A G 11: 3,679,787 E402G possibly damaging Het
Mphosph8 T C 14: 56,678,704 C486R probably benign Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mtcl1 G T 17: 66,343,623 H1616N probably benign Het
Myh10 A G 11: 68,807,289 probably benign Het
Myh8 A G 11: 67,292,876 E777G probably damaging Het
Nid1 A G 13: 13,509,486 H1186R probably benign Het
Nppb T A 4: 147,985,997 S8T probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr1039 A G 2: 86,131,261 V134A possibly damaging Het
Olfr1451 T A 19: 12,999,038 D17E probably benign Het
Olfr308 C T 7: 86,321,479 V158M possibly damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr356 A G 2: 36,937,692 N191S probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pdlim4 A G 11: 54,063,737 L48S possibly damaging Het
Phactr3 T C 2: 178,283,966 F345L probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Prcp T A 7: 92,901,280 V95D probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Sdccag8 C A 1: 176,955,889 Q655K probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Skap1 T C 11: 96,464,733 I10T possibly damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Smad2 T A 18: 76,288,084 C161* probably null Het
Spata31d1a G T 13: 59,701,043 D1090E probably damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Terf1 A G 1: 15,805,685 E3G probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tnfrsf26 C T 7: 143,617,840 probably null Het
Tor1aip1 A C 1: 156,007,562 M180R probably damaging Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Ttc30b G T 2: 75,936,785 H541Q probably damaging Het
Ttc39a A G 4: 109,442,706 Y464C probably damaging Het
Unc5a A G 13: 54,991,083 S92G probably damaging Het
Unc5d A C 8: 28,875,529 S143A possibly damaging Het
Usp34 A T 11: 23,464,556 H2833L possibly damaging Het
Wdr17 T G 8: 54,672,506 K446N probably damaging Het
Xirp2 A T 2: 67,508,048 Q211L possibly damaging Het
Xkr7 G A 2: 153,052,896 R256Q probably benign Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp758 A G 17: 22,375,970 H479R probably damaging Het
Zfp827 A G 8: 79,185,721 N284S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in 9030624J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:9030624J02Rik APN 7 118797047 critical splice donor site probably null
IGL00229:9030624J02Rik APN 7 118804191 splice site probably benign
IGL01066:9030624J02Rik APN 7 118773011 splice site probably null
IGL01433:9030624J02Rik APN 7 118774051 splice site probably null
IGL02381:9030624J02Rik APN 7 118775375 missense probably damaging 1.00
IGL02566:9030624J02Rik APN 7 118752832 missense probably benign 0.04
IGL03199:9030624J02Rik APN 7 118766388 missense probably benign 0.18
IGL03224:9030624J02Rik APN 7 118792553 unclassified probably benign
R0535:9030624J02Rik UTSW 7 118748181 missense possibly damaging 0.95
R1109:9030624J02Rik UTSW 7 118775329 missense probably damaging 0.97
R1378:9030624J02Rik UTSW 7 118794572 nonsense probably null
R1378:9030624J02Rik UTSW 7 118794573 missense probably damaging 1.00
R1412:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R1474:9030624J02Rik UTSW 7 118760213 missense probably damaging 1.00
R1586:9030624J02Rik UTSW 7 118809972 missense probably damaging 1.00
R1785:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1786:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1921:9030624J02Rik UTSW 7 118833748 missense probably damaging 0.98
R1971:9030624J02Rik UTSW 7 118775334 missense probably damaging 1.00
R2038:9030624J02Rik UTSW 7 118811874 missense probably damaging 0.98
R2107:9030624J02Rik UTSW 7 118794539 unclassified probably benign
R2130:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2131:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2133:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2405:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R2411:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R3910:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3911:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3912:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3971:9030624J02Rik UTSW 7 118833799 missense probably damaging 0.98
R4697:9030624J02Rik UTSW 7 118791448 missense probably damaging 1.00
R4964:9030624J02Rik UTSW 7 118780268 missense possibly damaging 0.84
R4980:9030624J02Rik UTSW 7 118807009 missense probably damaging 1.00
R5034:9030624J02Rik UTSW 7 118791388 missense probably damaging 0.99
R5309:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5312:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5743:9030624J02Rik UTSW 7 118797011 missense possibly damaging 0.89
R6017:9030624J02Rik UTSW 7 118809921 missense probably damaging 1.00
R6089:9030624J02Rik UTSW 7 118746435 missense possibly damaging 0.76
R6320:9030624J02Rik UTSW 7 118753849 missense probably benign 0.08
R6415:9030624J02Rik UTSW 7 118792646 missense probably damaging 1.00
R6861:9030624J02Rik UTSW 7 118743675 missense probably damaging 1.00
R7034:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7036:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7339:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R7456:9030624J02Rik UTSW 7 118804117 missense probably benign 0.01
X0028:9030624J02Rik UTSW 7 118800452 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTATATTCCAACTGTCAGAGTCAGC -3'
(R):5'- ACCGTGACTTCTAAGAGCTGG -3'

Sequencing Primer
(F):5'- GTCAGCCAGACAGTCTGTC -3'
(R):5'- CGTGACTTCTAAGAGCTGGACTGAG -3'
Posted On2014-10-01