Incidental Mutation 'R0194:Dntt'
ID 23340
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Name deoxynucleotidyltransferase, terminal
Synonyms Tdt
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0194 (G1)
Quality Score 206
Status Validated
Chromosome 19
Chromosomal Location 41017714-41047964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41027409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 159 (T159S)
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
AlphaFold P09838
Predicted Effect possibly damaging
Transcript: ENSMUST00000051806
AA Change: T159S

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: T159S

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112200
AA Change: T159S

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: T159S

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41,028,262 (GRCm39) missense probably benign 0.01
IGL01531:Dntt APN 19 41,041,677 (GRCm39) nonsense probably null
IGL01859:Dntt APN 19 41,025,743 (GRCm39) missense probably benign
IGL02053:Dntt APN 19 41,034,713 (GRCm39) missense probably benign 0.00
IGL02411:Dntt APN 19 41,041,424 (GRCm39) splice site probably null
IGL03180:Dntt APN 19 41,017,990 (GRCm39) missense probably benign 0.09
catbird UTSW 19 41,041,672 (GRCm39) missense probably damaging 1.00
mimetic UTSW 19 41,025,578 (GRCm39) splice site probably benign
wren UTSW 19 41,044,197 (GRCm39) critical splice acceptor site probably null
R0106:Dntt UTSW 19 41,044,185 (GRCm39) splice site probably benign
R0122:Dntt UTSW 19 41,041,477 (GRCm39) missense possibly damaging 0.95
R0266:Dntt UTSW 19 41,047,566 (GRCm39) missense probably damaging 0.99
R0377:Dntt UTSW 19 41,036,066 (GRCm39) nonsense probably null
R0412:Dntt UTSW 19 41,031,372 (GRCm39) missense probably damaging 1.00
R0604:Dntt UTSW 19 41,041,588 (GRCm39) missense probably benign 0.01
R1350:Dntt UTSW 19 41,025,578 (GRCm39) splice site probably benign
R1577:Dntt UTSW 19 41,044,224 (GRCm39) missense probably damaging 1.00
R1677:Dntt UTSW 19 41,017,923 (GRCm39) missense probably benign 0.26
R2567:Dntt UTSW 19 41,029,775 (GRCm39) missense possibly damaging 0.81
R4380:Dntt UTSW 19 41,041,672 (GRCm39) missense probably damaging 1.00
R4703:Dntt UTSW 19 41,028,242 (GRCm39) missense probably benign 0.00
R4999:Dntt UTSW 19 41,028,295 (GRCm39) missense probably damaging 0.99
R6257:Dntt UTSW 19 41,041,501 (GRCm39) missense probably damaging 1.00
R6757:Dntt UTSW 19 41,025,601 (GRCm39) missense probably damaging 1.00
R7340:Dntt UTSW 19 41,047,004 (GRCm39) critical splice acceptor site probably null
R7388:Dntt UTSW 19 41,027,418 (GRCm39) missense probably benign 0.01
R7553:Dntt UTSW 19 41,017,926 (GRCm39) missense probably damaging 0.99
R7806:Dntt UTSW 19 41,018,071 (GRCm39) missense probably benign 0.02
R8145:Dntt UTSW 19 41,044,224 (GRCm39) missense probably damaging 1.00
R8940:Dntt UTSW 19 41,046,990 (GRCm39) intron probably benign
R9085:Dntt UTSW 19 41,044,220 (GRCm39) missense probably damaging 1.00
R9110:Dntt UTSW 19 41,044,197 (GRCm39) critical splice acceptor site probably null
R9378:Dntt UTSW 19 41,027,356 (GRCm39) missense probably benign 0.05
YA93:Dntt UTSW 19 41,041,626 (GRCm39) missense probably benign
Z1177:Dntt UTSW 19 41,044,254 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAACAATCATACACGCCTGTGACT -3'
(R):5'- CTATGAACAAGGAGGCCCACTTGAC -3'

Sequencing Primer
(F):5'- GGTATGCAACACATTTTTGAGTCC -3'
(R):5'- CTTGACGAAGAACCAGAGGTC -3'
Posted On 2013-04-16