Incidental Mutation 'R2132:Wdr17'
ID233401
Institutional Source Beutler Lab
Gene Symbol Wdr17
Ensembl Gene ENSMUSG00000039375
Gene NameWD repeat domain 17
SynonymsB230207L18Rik, 3010002I12Rik
MMRRC Submission 040135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2132 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location54629055-54887184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54672506 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 446 (K446N)
Ref Sequence ENSEMBL: ENSMUSP00000122326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127511] [ENSMUST00000144482] [ENSMUST00000144711] [ENSMUST00000150488] [ENSMUST00000175915]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126316
Predicted Effect possibly damaging
Transcript: ENSMUST00000127511
AA Change: K470N

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115550
Gene: ENSMUSG00000039375
AA Change: K470N

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 162 202 1.58e2 SMART
WD40 205 252 4.26e1 SMART
WD40 255 298 1.15e0 SMART
WD40 383 422 1.59e-7 SMART
WD40 425 465 2.39e0 SMART
WD40 468 509 5.52e-2 SMART
WD40 511 550 4.14e-6 SMART
WD40 555 595 5.14e-11 SMART
WD40 598 638 6.58e-9 SMART
WD40 641 681 6.28e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144482
AA Change: K157N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134950
Gene: ENSMUSG00000039375
AA Change: K157N

DomainStartEndE-ValueType
Blast:WD40 16 65 2e-24 BLAST
WD40 70 109 1.59e-7 SMART
WD40 112 152 2.39e0 SMART
WD40 155 196 5.52e-2 SMART
WD40 198 237 4.14e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144711
AA Change: K453N

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117710
Gene: ENSMUSG00000039375
AA Change: K453N

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 194 235 7.64e1 SMART
WD40 238 281 1.15e0 SMART
WD40 366 405 1.59e-7 SMART
WD40 408 448 2.39e0 SMART
WD40 451 492 5.52e-2 SMART
WD40 494 533 4.14e-6 SMART
WD40 538 578 5.14e-11 SMART
WD40 581 621 6.58e-9 SMART
WD40 624 664 6.28e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150488
AA Change: K446N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122326
Gene: ENSMUSG00000039375
AA Change: K446N

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175915
AA Change: K446N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135805
Gene: ENSMUSG00000039375
AA Change: K446N

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Meta Mutation Damage Score 0.1182 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (117/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein. It is abundantly expressed in retina and testis, and is thought to be a candidate gene for retinal disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,476 probably benign Het
4930562C15Rik A C 16: 4,835,971 Q128P unknown Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
9130019O22Rik T C 7: 127,386,935 D8G probably benign Het
9530053A07Rik C T 7: 28,155,474 P1842S probably damaging Het
Abcc3 T A 11: 94,367,600 K473M probably benign Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrg7 C A 16: 56,767,918 A199S probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Ap2b1 T A 11: 83,324,761 probably benign Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
B3gnt3 G A 8: 71,693,327 T186M probably damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc157 A T 11: 4,150,004 V116E probably damaging Het
Ccdc85a G A 11: 28,434,151 T408I probably benign Het
Celf1 G T 2: 91,010,446 G353W probably damaging Het
Celsr1 T A 15: 86,031,967 I602F possibly damaging Het
Cenpb C T 2: 131,179,306 V191M probably damaging Het
Cenpn G A 8: 116,934,797 probably null Het
Cfap65 A C 1: 74,907,691 C1287G probably damaging Het
Cmya5 G A 13: 93,069,383 T3326I probably damaging Het
Cnn3 A T 3: 121,451,935 E100V probably damaging Het
Col4a4 G A 1: 82,497,860 R583C unknown Het
Commd7 A C 2: 153,621,666 probably benign Het
Csmd3 T C 15: 48,457,503 T304A probably benign Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
D730048I06Rik T G 9: 35,789,743 probably benign Het
Dclk2 T C 3: 86,920,046 N42S probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Dnaaf3 T A 7: 4,523,801 I426L probably benign Het
Dnah17 G A 11: 118,033,747 L3999F probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Dsg1a T A 18: 20,340,797 S976T probably damaging Het
Dstyk T A 1: 132,449,484 M29K probably null Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fat3 A G 9: 16,246,719 probably null Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Flnb A C 14: 7,873,376 D224A probably benign Het
Flnc G A 6: 29,443,676 V566M probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gli3 T A 13: 15,725,549 S1174T possibly damaging Het
Glmn A T 5: 107,578,455 V93E probably damaging Het
Glrx2 T C 1: 143,745,104 S74P possibly damaging Het
Gm13212 T A 4: 145,624,233 probably benign Het
Gm5422 G A 10: 31,248,933 noncoding transcript Het
Gpi1 T C 7: 34,205,914 K362E probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Gxylt1 A G 15: 93,244,970 *405R probably null Het
Heyl T C 4: 123,246,083 V145A probably damaging Het
Hhipl1 A C 12: 108,311,690 E92D probably damaging Het
Ifi207 A G 1: 173,729,771 F467S possibly damaging Het
Igf2r A T 17: 12,722,208 I462N probably benign Het
Inpp5b A T 4: 124,785,168 probably benign Het
Kansl2 A G 15: 98,529,397 I201T probably damaging Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kcnu1 T A 8: 25,851,900 I91N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Klrc3 T A 6: 129,641,538 Y94F probably benign Het
Lgals3bp T A 11: 118,393,287 T489S probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Magi1 T C 6: 93,697,274 E951G probably damaging Het
Mcm7 T C 5: 138,169,102 Q86R probably damaging Het
Med12l G T 3: 59,265,282 probably null Het
Morc2a A G 11: 3,679,787 E402G possibly damaging Het
Mphosph8 T C 14: 56,678,704 C486R probably benign Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mtcl1 G T 17: 66,343,623 H1616N probably benign Het
Myh10 A G 11: 68,807,289 probably benign Het
Myh8 A G 11: 67,292,876 E777G probably damaging Het
Nid1 A G 13: 13,509,486 H1186R probably benign Het
Nppb T A 4: 147,985,997 S8T probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr1039 A G 2: 86,131,261 V134A possibly damaging Het
Olfr1451 T A 19: 12,999,038 D17E probably benign Het
Olfr308 C T 7: 86,321,479 V158M possibly damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr356 A G 2: 36,937,692 N191S probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pdlim4 A G 11: 54,063,737 L48S possibly damaging Het
Phactr3 T C 2: 178,283,966 F345L probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Prcp T A 7: 92,901,280 V95D probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Sdccag8 C A 1: 176,955,889 Q655K probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Skap1 T C 11: 96,464,733 I10T possibly damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Smad2 T A 18: 76,288,084 C161* probably null Het
Spata31d1a G T 13: 59,701,043 D1090E probably damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Terf1 A G 1: 15,805,685 E3G probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tnfrsf26 C T 7: 143,617,840 probably null Het
Tor1aip1 A C 1: 156,007,562 M180R probably damaging Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Ttc30b G T 2: 75,936,785 H541Q probably damaging Het
Ttc39a A G 4: 109,442,706 Y464C probably damaging Het
Unc5a A G 13: 54,991,083 S92G probably damaging Het
Unc5d A C 8: 28,875,529 S143A possibly damaging Het
Usp34 A T 11: 23,464,556 H2833L possibly damaging Het
Xirp2 A T 2: 67,508,048 Q211L possibly damaging Het
Xkr7 G A 2: 153,052,896 R256Q probably benign Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp758 A G 17: 22,375,970 H479R probably damaging Het
Zfp827 A G 8: 79,185,721 N284S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Wdr17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Wdr17 APN 8 54687711 missense probably damaging 1.00
IGL00496:Wdr17 APN 8 54659579 splice site probably benign
IGL01318:Wdr17 APN 8 54672550 missense probably damaging 1.00
IGL01347:Wdr17 APN 8 54651345 missense probably benign
IGL01654:Wdr17 APN 8 54662879 missense probably damaging 1.00
IGL02010:Wdr17 APN 8 54659703 missense probably damaging 0.97
IGL02085:Wdr17 APN 8 54687736 nonsense probably null
IGL02205:Wdr17 APN 8 54696300 missense probably damaging 1.00
IGL02375:Wdr17 APN 8 54696388 missense possibly damaging 0.94
IGL02705:Wdr17 APN 8 54648215 splice site probably null
IGL02719:Wdr17 APN 8 54693054 splice site probably null
IGL03051:Wdr17 APN 8 54651314 missense probably damaging 0.99
IGL03131:Wdr17 APN 8 54696267 critical splice donor site probably null
IGL03172:Wdr17 APN 8 54661480 missense probably damaging 0.96
enthralled UTSW 8 54659681 missense possibly damaging 0.85
riveted UTSW 8 54632487 missense probably benign 0.00
thrilled UTSW 8 54696268 critical splice donor site probably null
IGL03138:Wdr17 UTSW 8 54649143 missense probably damaging 1.00
PIT4458001:Wdr17 UTSW 8 54673579 nonsense probably null
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0124:Wdr17 UTSW 8 54635491 missense probably damaging 1.00
R0226:Wdr17 UTSW 8 54663008 missense probably benign 0.08
R0270:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0271:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0288:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0321:Wdr17 UTSW 8 54696268 critical splice donor site probably null
R0464:Wdr17 UTSW 8 54670392 splice site probably benign
R0479:Wdr17 UTSW 8 54651421 splice site probably null
R0488:Wdr17 UTSW 8 54693052 unclassified probably benign
R0552:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0553:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0600:Wdr17 UTSW 8 54661495 missense probably damaging 1.00
R0621:Wdr17 UTSW 8 54643191 missense probably benign 0.18
R0655:Wdr17 UTSW 8 54649198 missense probably damaging 1.00
R0730:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0789:Wdr17 UTSW 8 54659572 splice site probably benign
R0854:Wdr17 UTSW 8 54703881 missense probably benign
R0879:Wdr17 UTSW 8 54661481 missense probably benign 0.08
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1497:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R1589:Wdr17 UTSW 8 54703907 intron probably benign
R1618:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R1768:Wdr17 UTSW 8 54673654 missense possibly damaging 0.84
R1778:Wdr17 UTSW 8 54690214 missense probably damaging 1.00
R1819:Wdr17 UTSW 8 54690124 missense probably benign 0.18
R1913:Wdr17 UTSW 8 54687726 missense probably damaging 1.00
R2129:Wdr17 UTSW 8 54632381 missense probably damaging 1.00
R2309:Wdr17 UTSW 8 54643248 missense probably benign
R3882:Wdr17 UTSW 8 54639501 missense possibly damaging 0.53
R4097:Wdr17 UTSW 8 54635469 missense probably damaging 1.00
R4372:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R4380:Wdr17 UTSW 8 54648407 intron probably benign
R4480:Wdr17 UTSW 8 54664964 critical splice donor site probably null
R4654:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4656:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4669:Wdr17 UTSW 8 54690048 missense possibly damaging 0.72
R4719:Wdr17 UTSW 8 54639876 missense probably benign 0.33
R4912:Wdr17 UTSW 8 54629861 missense probably damaging 1.00
R5000:Wdr17 UTSW 8 54665126 missense possibly damaging 0.82
R5073:Wdr17 UTSW 8 54690236 critical splice acceptor site probably null
R5176:Wdr17 UTSW 8 54653878 critical splice donor site probably null
R5194:Wdr17 UTSW 8 54687604 missense probably damaging 1.00
R5270:Wdr17 UTSW 8 54643186 missense probably benign 0.20
R5300:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5325:Wdr17 UTSW 8 54659681 missense possibly damaging 0.85
R5336:Wdr17 UTSW 8 54632318 missense probably damaging 1.00
R5394:Wdr17 UTSW 8 54639489 missense possibly damaging 0.73
R5424:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5425:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5426:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5548:Wdr17 UTSW 8 54703851 missense probably damaging 0.97
R5681:Wdr17 UTSW 8 54662869 missense probably damaging 1.00
R5722:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R5894:Wdr17 UTSW 8 54696300 missense probably damaging 1.00
R5906:Wdr17 UTSW 8 54639468 missense probably benign 0.33
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6391:Wdr17 UTSW 8 54661460 missense probably benign 0.04
R6605:Wdr17 UTSW 8 54681524 missense probably benign 0.16
R6892:Wdr17 UTSW 8 54673596 missense probably damaging 1.00
R7019:Wdr17 UTSW 8 54681453 missense probably damaging 1.00
R7257:Wdr17 UTSW 8 54632487 missense probably benign 0.00
R7481:Wdr17 UTSW 8 54661336 missense probably benign
R7868:Wdr17 UTSW 8 54696267 critical splice donor site probably null
R7939:Wdr17 UTSW 8 54687642 missense probably damaging 0.98
R7962:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R8017:Wdr17 UTSW 8 54638368 missense possibly damaging 0.73
R8122:Wdr17 UTSW 8 54664976 missense probably damaging 1.00
R8226:Wdr17 UTSW 8 54693120 missense possibly damaging 0.52
R8251:Wdr17 UTSW 8 54657232 missense probably damaging 1.00
R8413:Wdr17 UTSW 8 54662918 missense probably benign 0.08
V5088:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
X0022:Wdr17 UTSW 8 54639494 missense probably benign 0.04
X0066:Wdr17 UTSW 8 54673560 missense probably damaging 1.00
Z1177:Wdr17 UTSW 8 54643185 missense probably benign 0.03
Z1177:Wdr17 UTSW 8 54670379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGGTAAGACTTTGGGG -3'
(R):5'- TTTCAAAGGCATACACATACCCTTC -3'

Sequencing Primer
(F):5'- ACCAGGTAAGACTTTGGGGTTTCTG -3'
(R):5'- GCATTGCTGGTGCAACT -3'
Posted On2014-10-01