Incidental Mutation 'R2132:Cmya5'
ID233441
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 040135-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R2132 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93069383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 3326 (T3326I)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect probably damaging
Transcript: ENSMUST00000062122
AA Change: T3326I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: T3326I

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225665
Meta Mutation Damage Score 0.1819 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (117/124)
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,476 probably benign Het
4930562C15Rik A C 16: 4,835,971 Q128P unknown Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
9130019O22Rik T C 7: 127,386,935 D8G probably benign Het
9530053A07Rik C T 7: 28,155,474 P1842S probably damaging Het
Abcc3 T A 11: 94,367,600 K473M probably benign Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrg7 C A 16: 56,767,918 A199S probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Ap2b1 T A 11: 83,324,761 probably benign Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
B3gnt3 G A 8: 71,693,327 T186M probably damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc157 A T 11: 4,150,004 V116E probably damaging Het
Ccdc85a G A 11: 28,434,151 T408I probably benign Het
Celf1 G T 2: 91,010,446 G353W probably damaging Het
Celsr1 T A 15: 86,031,967 I602F possibly damaging Het
Cenpb C T 2: 131,179,306 V191M probably damaging Het
Cenpn G A 8: 116,934,797 probably null Het
Cfap65 A C 1: 74,907,691 C1287G probably damaging Het
Cnn3 A T 3: 121,451,935 E100V probably damaging Het
Col4a4 G A 1: 82,497,860 R583C unknown Het
Commd7 A C 2: 153,621,666 probably benign Het
Csmd3 T C 15: 48,457,503 T304A probably benign Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
D730048I06Rik T G 9: 35,789,743 probably benign Het
Dclk2 T C 3: 86,920,046 N42S probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Dnaaf3 T A 7: 4,523,801 I426L probably benign Het
Dnah17 G A 11: 118,033,747 L3999F probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Dsg1a T A 18: 20,340,797 S976T probably damaging Het
Dstyk T A 1: 132,449,484 M29K probably null Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fat3 A G 9: 16,246,719 probably null Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Flnb A C 14: 7,873,376 D224A probably benign Het
Flnc G A 6: 29,443,676 V566M probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gli3 T A 13: 15,725,549 S1174T possibly damaging Het
Glmn A T 5: 107,578,455 V93E probably damaging Het
Glrx2 T C 1: 143,745,104 S74P possibly damaging Het
Gm13212 T A 4: 145,624,233 probably benign Het
Gm5422 G A 10: 31,248,933 noncoding transcript Het
Gpi1 T C 7: 34,205,914 K362E probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Gxylt1 A G 15: 93,244,970 *405R probably null Het
Heyl T C 4: 123,246,083 V145A probably damaging Het
Hhipl1 A C 12: 108,311,690 E92D probably damaging Het
Ifi207 A G 1: 173,729,771 F467S possibly damaging Het
Igf2r A T 17: 12,722,208 I462N probably benign Het
Inpp5b A T 4: 124,785,168 probably benign Het
Kansl2 A G 15: 98,529,397 I201T probably damaging Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kcnu1 T A 8: 25,851,900 I91N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Klrc3 T A 6: 129,641,538 Y94F probably benign Het
Lgals3bp T A 11: 118,393,287 T489S probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Magi1 T C 6: 93,697,274 E951G probably damaging Het
Mcm7 T C 5: 138,169,102 Q86R probably damaging Het
Med12l G T 3: 59,265,282 probably null Het
Morc2a A G 11: 3,679,787 E402G possibly damaging Het
Mphosph8 T C 14: 56,678,704 C486R probably benign Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mtcl1 G T 17: 66,343,623 H1616N probably benign Het
Myh10 A G 11: 68,807,289 probably benign Het
Myh8 A G 11: 67,292,876 E777G probably damaging Het
Nid1 A G 13: 13,509,486 H1186R probably benign Het
Nppb T A 4: 147,985,997 S8T probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr1039 A G 2: 86,131,261 V134A possibly damaging Het
Olfr1451 T A 19: 12,999,038 D17E probably benign Het
Olfr308 C T 7: 86,321,479 V158M possibly damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr356 A G 2: 36,937,692 N191S probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pdlim4 A G 11: 54,063,737 L48S possibly damaging Het
Phactr3 T C 2: 178,283,966 F345L probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Prcp T A 7: 92,901,280 V95D probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Sdccag8 C A 1: 176,955,889 Q655K probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Skap1 T C 11: 96,464,733 I10T possibly damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Smad2 T A 18: 76,288,084 C161* probably null Het
Spata31d1a G T 13: 59,701,043 D1090E probably damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Terf1 A G 1: 15,805,685 E3G probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tnfrsf26 C T 7: 143,617,840 probably null Het
Tor1aip1 A C 1: 156,007,562 M180R probably damaging Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Ttc30b G T 2: 75,936,785 H541Q probably damaging Het
Ttc39a A G 4: 109,442,706 Y464C probably damaging Het
Unc5a A G 13: 54,991,083 S92G probably damaging Het
Unc5d A C 8: 28,875,529 S143A possibly damaging Het
Usp34 A T 11: 23,464,556 H2833L possibly damaging Het
Wdr17 T G 8: 54,672,506 K446N probably damaging Het
Xirp2 A T 2: 67,508,048 Q211L possibly damaging Het
Xkr7 G A 2: 153,052,896 R256Q probably benign Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp758 A G 17: 22,375,970 H479R probably damaging Het
Zfp827 A G 8: 79,185,721 N284S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense probably benign 0.00
R7088:Cmya5 UTSW 13 93091864 missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93089940 missense probably benign 0.41
R7177:Cmya5 UTSW 13 93095328 missense probably benign 0.00
R7188:Cmya5 UTSW 13 93046038 missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93090430 missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93095700 missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93092797 missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93092553 missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93091661 missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93069323 missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93091838 missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93097434 missense probably benign 0.02
R7552:Cmya5 UTSW 13 93069312 missense probably benign 0.41
R7624:Cmya5 UTSW 13 93090357 missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93083212 missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93094121 missense probably benign 0.13
R7753:Cmya5 UTSW 13 93098172 missense probably benign 0.18
R7757:Cmya5 UTSW 13 93098272 missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93094262 missense probably benign 0.00
R7825:Cmya5 UTSW 13 93097628 missense possibly damaging 0.53
RF020:Cmya5 UTSW 13 93069291 missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACAATTGTCACGTGTATAGGACC -3'
(R):5'- TATCAAAGGAATGGAGTTAGGCTGC -3'

Sequencing Primer
(F):5'- GGACCTTAATTTACAGTAAGATGCAG -3'
(R):5'- GTGAATTGTGTTTCCTTCCA -3'
Posted On2014-10-01