Incidental Mutation 'R2132:Csmd3'
ID233445
Institutional Source Beutler Lab
Gene Symbol Csmd3
Ensembl Gene ENSMUSG00000022311
Gene NameCUB and Sushi multiple domains 3
Synonyms4930500N14Rik
MMRRC Submission 040135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2132 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location47580637-48792063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48457503 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 304 (T304A)
Ref Sequence ENSEMBL: ENSMUSP00000124753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100670] [ENSMUST00000160658] [ENSMUST00000162830]
Predicted Effect probably benign
Transcript: ENSMUST00000100670
AA Change: T304A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311
AA Change: T304A

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160655
Predicted Effect probably benign
Transcript: ENSMUST00000160658
AA Change: T304A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311
AA Change: T304A

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
CCP 382 439 6.9e-14 SMART
CUB 444 555 9.22e-24 SMART
CCP 560 613 1.29e-13 SMART
CUB 617 725 6.87e-32 SMART
CCP 730 787 5.19e-9 SMART
CUB 791 899 3.23e-37 SMART
CCP 906 959 1.82e-13 SMART
CUB 963 1073 4.87e-23 SMART
CCP 1078 1133 1.82e-13 SMART
CUB 1137 1245 5.02e-25 SMART
CCP 1250 1306 2.5e-11 SMART
CUB 1310 1419 6.27e-26 SMART
CCP 1424 1480 4.41e-12 SMART
CUB 1484 1592 5.37e-34 SMART
CCP 1597 1654 1.18e-12 SMART
CUB 1658 1766 2.27e-23 SMART
CCP 1774 1831 1.84e-9 SMART
CUB 1835 1943 1.8e-35 SMART
CCP 1948 2003 4.48e-13 SMART
CUB 2007 2115 3.95e-32 SMART
CCP 2120 2175 4.02e-15 SMART
CUB 2179 2286 1.74e-33 SMART
CCP 2291 2348 5.82e-12 SMART
CUB 2353 2463 5.3e-24 SMART
CCP 2465 2523 2.11e-9 SMART
CCP 2528 2585 8.23e-12 SMART
CCP 2590 2643 1.14e-14 SMART
CCP 2648 2701 4.76e-17 SMART
CCP 2706 2759 1.85e-14 SMART
CCP 2764 2821 9.9e-15 SMART
CCP 2826 2879 1.79e-12 SMART
CCP 2887 2940 1.72e-14 SMART
CCP 2945 2999 3.17e-13 SMART
CCP 3004 3059 1.25e-11 SMART
CCP 3064 3117 1.25e-11 SMART
CCP 3122 3175 8.23e-12 SMART
CCP 3183 3237 5.6e-14 SMART
CCP 3242 3297 1.89e-11 SMART
transmembrane domain 3461 3483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160716
Predicted Effect probably benign
Transcript: ENSMUST00000162830
AA Change: T304A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311
AA Change: T304A

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Meta Mutation Damage Score 0.1027 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (117/124)
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,476 probably benign Het
4930562C15Rik A C 16: 4,835,971 Q128P unknown Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
9130019O22Rik T C 7: 127,386,935 D8G probably benign Het
9530053A07Rik C T 7: 28,155,474 P1842S probably damaging Het
Abcc3 T A 11: 94,367,600 K473M probably benign Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrg7 C A 16: 56,767,918 A199S probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Ap2b1 T A 11: 83,324,761 probably benign Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
B3gnt3 G A 8: 71,693,327 T186M probably damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc157 A T 11: 4,150,004 V116E probably damaging Het
Ccdc85a G A 11: 28,434,151 T408I probably benign Het
Celf1 G T 2: 91,010,446 G353W probably damaging Het
Celsr1 T A 15: 86,031,967 I602F possibly damaging Het
Cenpb C T 2: 131,179,306 V191M probably damaging Het
Cenpn G A 8: 116,934,797 probably null Het
Cfap65 A C 1: 74,907,691 C1287G probably damaging Het
Cmya5 G A 13: 93,069,383 T3326I probably damaging Het
Cnn3 A T 3: 121,451,935 E100V probably damaging Het
Col4a4 G A 1: 82,497,860 R583C unknown Het
Commd7 A C 2: 153,621,666 probably benign Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
D730048I06Rik T G 9: 35,789,743 probably benign Het
Dclk2 T C 3: 86,920,046 N42S probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Dnaaf3 T A 7: 4,523,801 I426L probably benign Het
Dnah17 G A 11: 118,033,747 L3999F probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Dsg1a T A 18: 20,340,797 S976T probably damaging Het
Dstyk T A 1: 132,449,484 M29K probably null Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fat3 A G 9: 16,246,719 probably null Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Flnb A C 14: 7,873,376 D224A probably benign Het
Flnc G A 6: 29,443,676 V566M probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gli3 T A 13: 15,725,549 S1174T possibly damaging Het
Glmn A T 5: 107,578,455 V93E probably damaging Het
Glrx2 T C 1: 143,745,104 S74P possibly damaging Het
Gm13212 T A 4: 145,624,233 probably benign Het
Gm5422 G A 10: 31,248,933 noncoding transcript Het
Gpi1 T C 7: 34,205,914 K362E probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Gxylt1 A G 15: 93,244,970 *405R probably null Het
Heyl T C 4: 123,246,083 V145A probably damaging Het
Hhipl1 A C 12: 108,311,690 E92D probably damaging Het
Ifi207 A G 1: 173,729,771 F467S possibly damaging Het
Igf2r A T 17: 12,722,208 I462N probably benign Het
Inpp5b A T 4: 124,785,168 probably benign Het
Kansl2 A G 15: 98,529,397 I201T probably damaging Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kcnu1 T A 8: 25,851,900 I91N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Klrc3 T A 6: 129,641,538 Y94F probably benign Het
Lgals3bp T A 11: 118,393,287 T489S probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Magi1 T C 6: 93,697,274 E951G probably damaging Het
Mcm7 T C 5: 138,169,102 Q86R probably damaging Het
Med12l G T 3: 59,265,282 probably null Het
Morc2a A G 11: 3,679,787 E402G possibly damaging Het
Mphosph8 T C 14: 56,678,704 C486R probably benign Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mtcl1 G T 17: 66,343,623 H1616N probably benign Het
Myh10 A G 11: 68,807,289 probably benign Het
Myh8 A G 11: 67,292,876 E777G probably damaging Het
Nid1 A G 13: 13,509,486 H1186R probably benign Het
Nppb T A 4: 147,985,997 S8T probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr1039 A G 2: 86,131,261 V134A possibly damaging Het
Olfr1451 T A 19: 12,999,038 D17E probably benign Het
Olfr308 C T 7: 86,321,479 V158M possibly damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr356 A G 2: 36,937,692 N191S probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pdlim4 A G 11: 54,063,737 L48S possibly damaging Het
Phactr3 T C 2: 178,283,966 F345L probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Prcp T A 7: 92,901,280 V95D probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Sdccag8 C A 1: 176,955,889 Q655K probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Skap1 T C 11: 96,464,733 I10T possibly damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Smad2 T A 18: 76,288,084 C161* probably null Het
Spata31d1a G T 13: 59,701,043 D1090E probably damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Terf1 A G 1: 15,805,685 E3G probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tnfrsf26 C T 7: 143,617,840 probably null Het
Tor1aip1 A C 1: 156,007,562 M180R probably damaging Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Ttc30b G T 2: 75,936,785 H541Q probably damaging Het
Ttc39a A G 4: 109,442,706 Y464C probably damaging Het
Unc5a A G 13: 54,991,083 S92G probably damaging Het
Unc5d A C 8: 28,875,529 S143A possibly damaging Het
Usp34 A T 11: 23,464,556 H2833L possibly damaging Het
Wdr17 T G 8: 54,672,506 K446N probably damaging Het
Xirp2 A T 2: 67,508,048 Q211L possibly damaging Het
Xkr7 G A 2: 153,052,896 R256Q probably benign Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp758 A G 17: 22,375,970 H479R probably damaging Het
Zfp827 A G 8: 79,185,721 N284S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Csmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Csmd3 APN 15 48287495 missense possibly damaging 0.61
IGL00591:Csmd3 APN 15 48004883 missense probably damaging 1.00
IGL00668:Csmd3 APN 15 47913945 missense probably damaging 1.00
IGL00753:Csmd3 APN 15 47644235 missense probably damaging 1.00
IGL00773:Csmd3 APN 15 47590719 missense probably damaging 0.96
IGL00926:Csmd3 APN 15 47710964 missense possibly damaging 0.87
IGL00942:Csmd3 APN 15 47847106 critical splice donor site probably null
IGL01080:Csmd3 APN 15 47881403 missense probably benign 0.12
IGL01314:Csmd3 APN 15 47849755 missense probably damaging 1.00
IGL01326:Csmd3 APN 15 47849785 missense probably benign 0.06
IGL01393:Csmd3 APN 15 48457599 missense possibly damaging 0.88
IGL01432:Csmd3 APN 15 47733499 missense probably damaging 1.00
IGL01519:Csmd3 APN 15 47596850 missense probably benign 0.31
IGL01530:Csmd3 APN 15 47838437 missense possibly damaging 0.95
IGL01530:Csmd3 APN 15 47669617 missense probably damaging 1.00
IGL01547:Csmd3 APN 15 47883617 missense probably benign 0.41
IGL01594:Csmd3 APN 15 47629239 missense probably benign 0.01
IGL01618:Csmd3 APN 15 48011083 missense probably benign 0.05
IGL01670:Csmd3 APN 15 47611829 missense probably damaging 1.00
IGL01680:Csmd3 APN 15 47970030 missense probably damaging 1.00
IGL01734:Csmd3 APN 15 48185304 missense probably damaging 1.00
IGL01777:Csmd3 APN 15 47698198 missense probably benign 0.06
IGL01779:Csmd3 APN 15 47857894 missense probably benign 0.10
IGL01820:Csmd3 APN 15 47607142 nonsense probably null
IGL01843:Csmd3 APN 15 47658999 splice site probably benign
IGL01919:Csmd3 APN 15 47675772 missense possibly damaging 0.62
IGL01986:Csmd3 APN 15 47659195 missense possibly damaging 0.82
IGL02049:Csmd3 APN 15 48001474 missense possibly damaging 0.91
IGL02065:Csmd3 APN 15 47666628 missense probably damaging 1.00
IGL02112:Csmd3 APN 15 48313869 missense possibly damaging 0.95
IGL02133:Csmd3 APN 15 47857942 missense possibly damaging 0.86
IGL02203:Csmd3 APN 15 47849677 splice site probably null
IGL02215:Csmd3 APN 15 47585688 missense probably damaging 1.00
IGL02234:Csmd3 APN 15 47948116 missense probably damaging 1.00
IGL02326:Csmd3 APN 15 47755963 splice site probably benign
IGL02478:Csmd3 APN 15 47838398 splice site probably benign
IGL02491:Csmd3 APN 15 47914115 splice site probably benign
IGL02598:Csmd3 APN 15 47669690 missense probably damaging 0.98
IGL02626:Csmd3 APN 15 47704107 splice site probably benign
IGL02696:Csmd3 APN 15 47669669 missense probably benign 0.33
IGL02876:Csmd3 APN 15 47606096 splice site probably benign
IGL02971:Csmd3 APN 15 47913929 splice site probably benign
IGL03068:Csmd3 APN 15 47847121 missense possibly damaging 0.69
IGL03087:Csmd3 APN 15 47977033 missense probably damaging 1.00
IGL03114:Csmd3 APN 15 47820451 missense probably damaging 0.99
IGL03146:Csmd3 APN 15 47881477 missense probably benign 0.25
IGL03193:Csmd3 APN 15 47629230 splice site probably benign
IGL03274:Csmd3 APN 15 47645504 missense probably damaging 1.00
R0040:Csmd3 UTSW 15 47633816 missense probably damaging 1.00
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0119:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0124:Csmd3 UTSW 15 47590716 missense probably damaging 1.00
R0127:Csmd3 UTSW 15 47981930 missense probably benign 0.45
R0136:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0201:Csmd3 UTSW 15 47619729 splice site probably benign
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0318:Csmd3 UTSW 15 47659153 missense probably damaging 1.00
R0369:Csmd3 UTSW 15 47970147 missense probably damaging 1.00
R0391:Csmd3 UTSW 15 47657573 missense probably damaging 1.00
R0499:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0506:Csmd3 UTSW 15 48457511 missense probably benign 0.00
R0606:Csmd3 UTSW 15 48457662 missense probably benign
R0639:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0658:Csmd3 UTSW 15 48011147 missense possibly damaging 0.66
R0673:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0689:Csmd3 UTSW 15 47756025 missense probably benign 0.19
R0696:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R0799:Csmd3 UTSW 15 48185384 splice site probably benign
R0834:Csmd3 UTSW 15 47883677 intron probably benign
R0894:Csmd3 UTSW 15 47857920 missense possibly damaging 0.95
R0926:Csmd3 UTSW 15 47977033 missense probably damaging 1.00
R0943:Csmd3 UTSW 15 47675739 missense probably damaging 0.99
R0944:Csmd3 UTSW 15 47611831 missense probably damaging 1.00
R0967:Csmd3 UTSW 15 47857831 missense probably null 0.89
R0973:Csmd3 UTSW 15 47659089 missense probably damaging 1.00
R1055:Csmd3 UTSW 15 47881537 missense probably damaging 1.00
R1066:Csmd3 UTSW 15 47913965 missense probably damaging 1.00
R1086:Csmd3 UTSW 15 47695755 missense probably damaging 0.99
R1103:Csmd3 UTSW 15 47948006 missense probably damaging 1.00
R1136:Csmd3 UTSW 15 47675817 missense probably damaging 1.00
R1139:Csmd3 UTSW 15 47695836 missense probably damaging 1.00
R1158:Csmd3 UTSW 15 48292774 splice site probably null
R1215:Csmd3 UTSW 15 48004831 unclassified probably null
R1233:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R1271:Csmd3 UTSW 15 48011059 missense probably benign 0.11
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1479:Csmd3 UTSW 15 47857886 missense probably damaging 1.00
R1480:Csmd3 UTSW 15 47731929 missense possibly damaging 0.90
R1526:Csmd3 UTSW 15 47585632 critical splice donor site probably null
R1527:Csmd3 UTSW 15 47948087 missense probably benign 0.08
R1539:Csmd3 UTSW 15 47820398 missense probably benign 0.24
R1544:Csmd3 UTSW 15 47611898 splice site probably null
R1548:Csmd3 UTSW 15 47981975 missense possibly damaging 0.91
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1619:Csmd3 UTSW 15 47949950 missense probably damaging 1.00
R1630:Csmd3 UTSW 15 47838522 missense possibly damaging 0.66
R1665:Csmd3 UTSW 15 47696789 missense probably damaging 1.00
R1680:Csmd3 UTSW 15 47741170 missense probably damaging 1.00
R1725:Csmd3 UTSW 15 47596807 missense probably damaging 1.00
R1743:Csmd3 UTSW 15 48622089 missense probably damaging 1.00
R1749:Csmd3 UTSW 15 47585660 missense probably damaging 1.00
R1752:Csmd3 UTSW 15 47660273 missense probably benign 0.15
R1769:Csmd3 UTSW 15 47704109 splice site probably benign
R1775:Csmd3 UTSW 15 47899739 missense probably damaging 0.99
R1795:Csmd3 UTSW 15 47857920 missense possibly damaging 0.95
R1819:Csmd3 UTSW 15 47753735 missense possibly damaging 0.56
R1840:Csmd3 UTSW 15 47607164 missense probably damaging 1.00
R1860:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1861:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1879:Csmd3 UTSW 15 47657519 missense possibly damaging 0.90
R1958:Csmd3 UTSW 15 48004639 critical splice donor site probably null
R1965:Csmd3 UTSW 15 47849748 missense probably benign 0.15
R1970:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R2029:Csmd3 UTSW 15 47838579 missense probably damaging 1.00
R2051:Csmd3 UTSW 15 48621993 critical splice donor site probably null
R2108:Csmd3 UTSW 15 48004861 missense possibly damaging 0.81
R2146:Csmd3 UTSW 15 47741236 frame shift probably null
R2147:Csmd3 UTSW 15 47741236 frame shift probably null
R2148:Csmd3 UTSW 15 47741236 frame shift probably null
R2157:Csmd3 UTSW 15 47695787 missense probably damaging 0.99
R2159:Csmd3 UTSW 15 47741236 frame shift probably null
R2160:Csmd3 UTSW 15 47741236 frame shift probably null
R2161:Csmd3 UTSW 15 47741236 frame shift probably null
R2162:Csmd3 UTSW 15 47741236 frame shift probably null
R2164:Csmd3 UTSW 15 47741236 frame shift probably null
R2213:Csmd3 UTSW 15 47820447 missense possibly damaging 0.92
R2301:Csmd3 UTSW 15 47731998 missense probably damaging 1.00
R2302:Csmd3 UTSW 15 48314051 missense probably benign
R2355:Csmd3 UTSW 15 47741236 frame shift probably null
R2497:Csmd3 UTSW 15 47741236 frame shift probably null
R2509:Csmd3 UTSW 15 47741236 frame shift probably null
R2566:Csmd3 UTSW 15 47741236 frame shift probably null
R2567:Csmd3 UTSW 15 47741236 frame shift probably null
R2568:Csmd3 UTSW 15 47741236 frame shift probably null
R2570:Csmd3 UTSW 15 47741236 frame shift probably null
R2571:Csmd3 UTSW 15 47741236 frame shift probably null
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2907:Csmd3 UTSW 15 48011053 missense probably damaging 0.99
R3116:Csmd3 UTSW 15 47657599 missense probably damaging 1.00
R3423:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3425:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3508:Csmd3 UTSW 15 47741236 frame shift probably null
R3746:Csmd3 UTSW 15 47849766 missense probably benign 0.04
R3813:Csmd3 UTSW 15 48791813 missense possibly damaging 0.82
R3832:Csmd3 UTSW 15 47741236 frame shift probably null
R3959:Csmd3 UTSW 15 47644189 missense probably benign 0.18
R4042:Csmd3 UTSW 15 47614084 missense probably damaging 1.00
R4043:Csmd3 UTSW 15 47755966 critical splice donor site probably null
R4191:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4192:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4419:Csmd3 UTSW 15 47704311 missense probably damaging 1.00
R4426:Csmd3 UTSW 15 47669185 missense possibly damaging 0.51
R4434:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4438:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4490:Csmd3 UTSW 15 48314033 missense possibly damaging 0.83
R4562:Csmd3 UTSW 15 47899844 missense probably benign 0.32
R4604:Csmd3 UTSW 15 48004815 missense possibly damaging 0.90
R4620:Csmd3 UTSW 15 47585753 missense probably benign 0.09
R4632:Csmd3 UTSW 15 48011209 missense probably damaging 0.99
R4679:Csmd3 UTSW 15 48161083 nonsense probably null
R4696:Csmd3 UTSW 15 47913968 missense probably benign 0.24
R4718:Csmd3 UTSW 15 47698150 nonsense probably null
R4723:Csmd3 UTSW 15 47669160 missense probably benign 0.29
R4801:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4802:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4806:Csmd3 UTSW 15 48314068 missense probably benign
R4816:Csmd3 UTSW 15 47857934 missense possibly damaging 0.68
R4935:Csmd3 UTSW 15 48161084 missense probably damaging 1.00
R4955:Csmd3 UTSW 15 48673518 missense probably damaging 0.99
R4991:Csmd3 UTSW 15 48001478 missense probably damaging 1.00
R5031:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R5034:Csmd3 UTSW 15 47629287 missense possibly damaging 0.94
R5035:Csmd3 UTSW 15 47590779 missense probably damaging 1.00
R5120:Csmd3 UTSW 15 48673495 nonsense probably null
R5224:Csmd3 UTSW 15 47888684 missense possibly damaging 0.91
R5235:Csmd3 UTSW 15 47629278 missense probably benign 0.20
R5279:Csmd3 UTSW 15 48791944 unclassified probably null
R5360:Csmd3 UTSW 15 47669203 missense probably damaging 0.99
R5365:Csmd3 UTSW 15 48004749 missense possibly damaging 0.68
R5379:Csmd3 UTSW 15 47636450 nonsense probably null
R5381:Csmd3 UTSW 15 47741215 missense probably benign 0.21
R5393:Csmd3 UTSW 15 47633703 missense probably damaging 1.00
R5413:Csmd3 UTSW 15 47838435 missense probably damaging 1.00
R5549:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5550:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5551:Csmd3 UTSW 15 48314096 missense probably benign 0.13
R5567:Csmd3 UTSW 15 47645468 missense possibly damaging 0.92
R5621:Csmd3 UTSW 15 48313978 missense possibly damaging 0.84
R5668:Csmd3 UTSW 15 47695755 missense possibly damaging 0.48
R5677:Csmd3 UTSW 15 48622051 missense probably damaging 0.98
R5701:Csmd3 UTSW 15 47650221 missense probably damaging 1.00
R5701:Csmd3 UTSW 15 48540333 missense probably damaging 0.99
R5871:Csmd3 UTSW 15 47888716 missense probably damaging 0.98
R5872:Csmd3 UTSW 15 47582527 missense probably damaging 1.00
R5874:Csmd3 UTSW 15 47644270 missense probably damaging 1.00
R5952:Csmd3 UTSW 15 47733505 missense probably damaging 0.98
R5956:Csmd3 UTSW 15 48791882 missense possibly damaging 0.84
R5966:Csmd3 UTSW 15 47849739 missense probably damaging 0.96
R5969:Csmd3 UTSW 15 47947990 missense probably damaging 1.00
R5989:Csmd3 UTSW 15 47590764 missense possibly damaging 0.69
R6017:Csmd3 UTSW 15 48314012 missense possibly damaging 0.95
R6057:Csmd3 UTSW 15 47755391 missense probably damaging 1.00
R6127:Csmd3 UTSW 15 47650228 missense probably damaging 1.00
R6178:Csmd3 UTSW 15 48673458 missense probably damaging 1.00
R6198:Csmd3 UTSW 15 48313877 missense probably benign 0.28
R6213:Csmd3 UTSW 15 47629260 missense probably damaging 1.00
R6256:Csmd3 UTSW 15 47669729 missense probably damaging 1.00
R6274:Csmd3 UTSW 15 47621437 missense probably benign
R6327:Csmd3 UTSW 15 47881387 missense probably damaging 1.00
R6354:Csmd3 UTSW 15 47881489 missense probably damaging 1.00
R6405:Csmd3 UTSW 15 47820371 missense probably damaging 0.99
R6410:Csmd3 UTSW 15 48673407 missense probably damaging 1.00
R6416:Csmd3 UTSW 15 48673560 missense probably damaging 1.00
R6463:Csmd3 UTSW 15 47676479 missense probably damaging 1.00
R6536:Csmd3 UTSW 15 47838467 missense probably damaging 1.00
R6625:Csmd3 UTSW 15 47607075 missense probably benign 0.02
R6695:Csmd3 UTSW 15 47857834 missense probably damaging 0.99
R6895:Csmd3 UTSW 15 47666514 splice site probably null
R6906:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R6914:Csmd3 UTSW 15 48011138 missense possibly damaging 0.53
R6920:Csmd3 UTSW 15 47644205 missense probably damaging 1.00
R7024:Csmd3 UTSW 15 47710991 missense probably damaging 1.00
R7178:Csmd3 UTSW 15 47590774 missense
R7192:Csmd3 UTSW 15 47704237 missense
R7220:Csmd3 UTSW 15 48457598 missense probably damaging 0.99
R7362:Csmd3 UTSW 15 47755992 missense possibly damaging 0.65
R7380:Csmd3 UTSW 15 47586965 missense
R7397:Csmd3 UTSW 15 47695734 missense
R7467:Csmd3 UTSW 15 47629244 missense
R7585:Csmd3 UTSW 15 48622075 missense possibly damaging 0.76
R7623:Csmd3 UTSW 15 47949938 missense
R7649:Csmd3 UTSW 15 47669143 missense
R7691:Csmd3 UTSW 15 47741173 missense
R7695:Csmd3 UTSW 15 47820381 missense
U24488:Csmd3 UTSW 15 47710399 missense probably damaging 1.00
V8831:Csmd3 UTSW 15 48457696 missense probably damaging 0.96
X0021:Csmd3 UTSW 15 47970093 nonsense probably null
Z1088:Csmd3 UTSW 15 47636393 missense probably damaging 1.00
Z1088:Csmd3 UTSW 15 47847281 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACTATCCTTACTAATCCTGTGAC -3'
(R):5'- AGGTTCCAGTGGCATCATATCC -3'

Sequencing Primer
(F):5'- GTACTGATGTAACATTGACTGAGTC -3'
(R):5'- CAGCCCGGGTTTTCCTAATGAATAC -3'
Posted On2014-10-01