Mutagenetix > Incidental Mutation

Incidental Mutation 'R2132:Celsr1'

233448

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

MMRRC Submission

040135-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.630) question?

Stock #

R2132 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86031967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 602 (I602F)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000016172
AA Change: I602F

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: I602F

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Meta Mutation Damage Score

0.2100

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

94% (117/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	G	5: 87,964,476		probably benign	Het
4930562C15Rik	A	C	16: 4,835,971	Q128P	unknown	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
9130019O22Rik	T	C	7: 127,386,935	D8G	probably benign	Het
9530053A07Rik	C	T	7: 28,155,474	P1842S	probably damaging	Het
Abcc3	T	A	11: 94,367,600	K473M	probably benign	Het
Acacb	TGGGG	TGGG	5: 114,209,767		probably null	Het
Adgrg7	C	A	16: 56,767,918	A199S	probably damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Ap2b1	T	A	11: 83,324,761		probably benign	Het
Atat1	A	G	17: 35,909,439	S54P	probably damaging	Het
Atp13a2	T	A	4: 141,005,016	M864K	probably damaging	Het
B3gnt3	G	A	8: 71,693,327	T186M	probably damaging	Het
Cars	C	A	7: 143,592,474	R71M	probably damaging	Het
Ccdc157	A	T	11: 4,150,004	V116E	probably damaging	Het
Ccdc85a	G	A	11: 28,434,151	T408I	probably benign	Het
Celf1	G	T	2: 91,010,446	G353W	probably damaging	Het
Cenpb	C	T	2: 131,179,306	V191M	probably damaging	Het
Cenpn	G	A	8: 116,934,797		probably null	Het
Cfap65	A	C	1: 74,907,691	C1287G	probably damaging	Het
Cmya5	G	A	13: 93,069,383	T3326I	probably damaging	Het
Cnn3	A	T	3: 121,451,935	E100V	probably damaging	Het
Col4a4	G	A	1: 82,497,860	R583C	unknown	Het
Commd7	A	C	2: 153,621,666		probably benign	Het
Csmd3	T	C	15: 48,457,503	T304A	probably benign	Het
Cyp4a14	A	T	4: 115,491,391	S325R	probably damaging	Het
D730048I06Rik	T	G	9: 35,789,743		probably benign	Het
Dclk2	T	C	3: 86,920,046	N42S	probably benign	Het
Dmrta1	A	T	4: 89,688,709	Q134L	probably damaging	Het
Dnaaf3	T	A	7: 4,523,801	I426L	probably benign	Het
Dnah17	G	A	11: 118,033,747	L3999F	probably damaging	Het
Dock6	A	G	9: 21,846,518	S97P	probably benign	Het
Dsg1a	T	A	18: 20,340,797	S976T	probably damaging	Het
Dstyk	T	A	1: 132,449,484	M29K	probably null	Het
Eif3i	A	T	4: 129,596,926	H18Q	probably benign	Het
Epm2a	A	G	10: 11,343,682	E71G	probably benign	Het
Eps15l1	A	T	8: 72,386,868	V260D	probably benign	Het
Faf1	A	G	4: 109,710,845	N34S	probably damaging	Het
Fat3	A	G	9: 16,246,719		probably null	Het
Fbxw10	T	A	11: 62,859,857	I422N	probably damaging	Het
Fkbp15	C	A	4: 62,327,899	G431W	probably damaging	Het
Flnb	A	C	14: 7,873,376	D224A	probably benign	Het
Flnc	G	A	6: 29,443,676	V566M	probably damaging	Het
Gatsl2	G	A	5: 134,136,153	C187Y	probably damaging	Het
Gli3	T	A	13: 15,725,549	S1174T	possibly damaging	Het
Glmn	A	T	5: 107,578,455	V93E	probably damaging	Het
Glrx2	T	C	1: 143,745,104	S74P	possibly damaging	Het
Gm13212	T	A	4: 145,624,233		probably benign	Het
Gm5422	G	A	10: 31,248,933		noncoding transcript	Het
Gpi1	T	C	7: 34,205,914	K362E	probably damaging	Het
Gtpbp2	T	C	17: 46,161,202	M21T	probably benign	Het
Gxylt1	A	G	15: 93,244,970	*405R	probably null	Het
Heyl	T	C	4: 123,246,083	V145A	probably damaging	Het
Hhipl1	A	C	12: 108,311,690	E92D	probably damaging	Het
Ifi207	A	G	1: 173,729,771	F467S	possibly damaging	Het
Igf2r	A	T	17: 12,722,208	I462N	probably benign	Het
Inpp5b	A	T	4: 124,785,168		probably benign	Het
Kansl2	A	G	15: 98,529,397	I201T	probably damaging	Het
Kcnh8	T	C	17: 52,893,933	V465A	probably damaging	Het
Kcnu1	T	A	8: 25,851,900	I91N	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Klrc3	T	A	6: 129,641,538	Y94F	probably benign	Het
Lgals3bp	T	A	11: 118,393,287	T489S	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Magi1	T	C	6: 93,697,274	E951G	probably damaging	Het
Mcm7	T	C	5: 138,169,102	Q86R	probably damaging	Het
Med12l	G	T	3: 59,265,282		probably null	Het
Morc2a	A	G	11: 3,679,787	E402G	possibly damaging	Het
Mphosph8	T	C	14: 56,678,704	C486R	probably benign	Het
Mpo	A	G	11: 87,797,361	D282G	possibly damaging	Het
Mtcl1	G	T	17: 66,343,623	H1616N	probably benign	Het
Myh10	A	G	11: 68,807,289		probably benign	Het
Myh8	A	G	11: 67,292,876	E777G	probably damaging	Het
Nid1	A	G	13: 13,509,486	H1186R	probably benign	Het
Nppb	T	A	4: 147,985,997	S8T	probably benign	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Ntrk3	G	A	7: 78,477,935		probably benign	Het
Olfr1039	A	G	2: 86,131,261	V134A	possibly damaging	Het
Olfr1451	T	A	19: 12,999,038	D17E	probably benign	Het
Olfr308	C	T	7: 86,321,479	V158M	possibly damaging	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr356	A	G	2: 36,937,692	N191S	probably benign	Het
Olfr453	C	A	6: 42,744,135	L33M	possibly damaging	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Pard6g	T	C	18: 80,117,308	V212A	probably damaging	Het
Pdlim4	A	G	11: 54,063,737	L48S	possibly damaging	Het
Phactr3	T	C	2: 178,283,966	F345L	probably benign	Het
Plcb1	T	A	2: 135,325,667	Y460*	probably null	Het
Prcp	T	A	7: 92,901,280	V95D	probably benign	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Ror1	A	G	4: 100,410,025	N308D	probably benign	Het
Sdccag8	C	A	1: 176,955,889	Q655K	probably damaging	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Skap1	T	C	11: 96,464,733	I10T	possibly damaging	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Smad2	T	A	18: 76,288,084	C161*	probably null	Het
Spata31d1a	G	T	13: 59,701,043	D1090E	probably damaging	Het
Stard13	T	C	5: 151,045,168	Y879C	probably damaging	Het
Tdrd6	T	C	17: 43,624,833	T1775A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Terf1	A	G	1: 15,805,685	E3G	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tnfrsf26	C	T	7: 143,617,840		probably null	Het
Tor1aip1	A	C	1: 156,007,562	M180R	probably damaging	Het
Trabd2b	A	T	4: 114,610,008	Q478L	probably benign	Het
Trim41	C	A	11: 48,807,592	G516W	probably damaging	Het
Ttc30b	G	T	2: 75,936,785	H541Q	probably damaging	Het
Ttc39a	A	G	4: 109,442,706	Y464C	probably damaging	Het
Unc5a	A	G	13: 54,991,083	S92G	probably damaging	Het
Unc5d	A	C	8: 28,875,529	S143A	possibly damaging	Het
Usp34	A	T	11: 23,464,556	H2833L	possibly damaging	Het
Wdr17	T	G	8: 54,672,506	K446N	probably damaging	Het
Xirp2	A	T	2: 67,508,048	Q211L	possibly damaging	Het
Xkr7	G	A	2: 153,052,896	R256Q	probably benign	Het
Zfp236	T	C	18: 82,621,304	M1225V	probably benign	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp758	A	G	17: 22,375,970	H479R	probably damaging	Het
Zfp827	A	G	8: 79,185,721	N284S	possibly damaging	Het
Zfyve26	T	A	12: 79,268,434	I1423F	possibly damaging	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85931345	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86030836	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85922235	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86030491	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85926190	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85929895	missense	probably benign
IGL01931:Celsr1	APN	15	85907660	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85963223	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85907721	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85979004	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85929907	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86031226	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85941136	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85900688	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86030617	nonsense	probably null
IGL02899:Celsr1	APN	15	86031726	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85901472	missense	probably benign
IGL03212:Celsr1	APN	15	85930677	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85922235	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85900937	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	86032414	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85929419	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	86030762	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85902864	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85903365	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85932323	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85901597	missense	probably benign
R0792:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85903288	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86031279	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86032047	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85979146	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1522:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86031062	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85932457	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86030323	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86032685	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86032759	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86032887	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86030547	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85963223	missense	probably benign	0.35
R2189:Celsr1	UTSW	15	85979230	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85916723	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86031807	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85978827	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85963133	missense	probably benign	0.00
R4414:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4416:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85916756	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86030494	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85932460	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85906029	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85937953	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85937911	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85939134	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85932384	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85930546	missense	probably benign
R5310:Celsr1	UTSW	15	85926222	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85931282	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	86030767	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85941264	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86032955	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85904014	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85937975	missense	probably benign
R5915:Celsr1	UTSW	15	86030349	missense	probably damaging	0.96
R5932:Celsr1	UTSW	15	86032704	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86032500	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85919038	splice site	probably null
R6050:Celsr1	UTSW	15	85930611	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85932411	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85901021	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85921193	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85916687	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85928330	missense	probably benign
R6320:Celsr1	UTSW	15	85900959	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86031684	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85978920	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85963285	missense	probably benign
R6615:Celsr1	UTSW	15	85902114	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85918934	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85905914	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85907598	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86031495	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86030782	missense	probably benign
R6838:Celsr1	UTSW	15	85939194	missense	probably benign
R6886:Celsr1	UTSW	15	86031654	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85905478	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86032655	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85932451	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86033008	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86030514	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86030674	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85907673	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86033392	missense	probably benign
R7491:Celsr1	UTSW	15	86032518	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85929872	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85978732	nonsense	probably null
R7741:Celsr1	UTSW	15	85979102	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85932409	missense	probably benign
R7974:Celsr1	UTSW	15	86031030	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85939155	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86031600	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85902889	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85979235	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86033085	nonsense	probably null
R8290:Celsr1	UTSW	15	86033085	nonsense	probably null
R8292:Celsr1	UTSW	15	85907618	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85922244	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85932300	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86031414	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86033085	nonsense	probably null
R8384:Celsr1	UTSW	15	86033085	nonsense	probably null
R8452:Celsr1	UTSW	15	86033085	nonsense	probably null
R8463:Celsr1	UTSW	15	86030214	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86033085	nonsense	probably null
R8480:Celsr1	UTSW	15	86033085	nonsense	probably null
R8493:Celsr1	UTSW	15	85938006	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85939105	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86033085	nonsense	probably null
R8771:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85937993	missense	probably benign	0.01
R8905:Celsr1	UTSW	15	85904068	intron	probably benign
R8924:Celsr1	UTSW	15	86032470	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85963139	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	86030571	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85919016	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	86033085	nonsense	probably null
R9196:Celsr1	UTSW	15	86033085	nonsense	probably null
R9198:Celsr1	UTSW	15	86033085	nonsense	probably null
R9200:Celsr1	UTSW	15	86033085	nonsense	probably null
R9201:Celsr1	UTSW	15	86033085	nonsense	probably null
R9202:Celsr1	UTSW	15	86033085	nonsense	probably null
R9203:Celsr1	UTSW	15	86033085	nonsense	probably null
R9222:Celsr1	UTSW	15	85931270	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	86030850	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	86033085	nonsense	probably null
R9386:Celsr1	UTSW	15	85979030	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	86033085	nonsense	probably null
R9401:Celsr1	UTSW	15	86033085	nonsense	probably null
R9415:Celsr1	UTSW	15	86033085	nonsense	probably null
R9428:Celsr1	UTSW	15	85931348	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85922334	splice site	probably benign
R9493:Celsr1	UTSW	15	85901145	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	86033085	nonsense	probably null
R9499:Celsr1	UTSW	15	86033085	nonsense	probably null
R9607:Celsr1	UTSW	15	86031028	missense
R9673:Celsr1	UTSW	15	86033085	nonsense	probably null
Z1176:Celsr1	UTSW	15	85963100	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85978851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGCTATAGTGTTCCACCTCC -3'
(R):5'- TATCAACCCGCTGGACTTCG -3'

Sequencing Primer
(F):5'- ATAGTGTTCCACCTCCTCACGG -3'
(R):5'- AGGCCATCCGGGAGTACAC -3'

Posted On

2014-10-01