Mutagenetix > Incidental Mutation

Incidental Mutation 'R2132:Igf2r'

233454

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

040135-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.895) question?

Stock #

R2132 (G1)

Quality Score

157

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12722208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 462 (I462N)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably benign
Transcript: ENSMUST00000024599
AA Change: I462N

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: I462N

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

94% (117/124)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	G	5: 87,964,476		probably benign	Het
4930562C15Rik	A	C	16: 4,835,971	Q128P	unknown	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
9130019O22Rik	T	C	7: 127,386,935	D8G	probably benign	Het
9530053A07Rik	C	T	7: 28,155,474	P1842S	probably damaging	Het
Abcc3	T	A	11: 94,367,600	K473M	probably benign	Het
Acacb	TGGGG	TGGG	5: 114,209,767		probably null	Het
Adgrg7	C	A	16: 56,767,918	A199S	probably damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Ap2b1	T	A	11: 83,324,761		probably benign	Het
Atat1	A	G	17: 35,909,439	S54P	probably damaging	Het
Atp13a2	T	A	4: 141,005,016	M864K	probably damaging	Het
B3gnt3	G	A	8: 71,693,327	T186M	probably damaging	Het
Cars	C	A	7: 143,592,474	R71M	probably damaging	Het
Ccdc157	A	T	11: 4,150,004	V116E	probably damaging	Het
Ccdc85a	G	A	11: 28,434,151	T408I	probably benign	Het
Celf1	G	T	2: 91,010,446	G353W	probably damaging	Het
Celsr1	T	A	15: 86,031,967	I602F	possibly damaging	Het
Cenpb	C	T	2: 131,179,306	V191M	probably damaging	Het
Cenpn	G	A	8: 116,934,797		probably null	Het
Cfap65	A	C	1: 74,907,691	C1287G	probably damaging	Het
Cmya5	G	A	13: 93,069,383	T3326I	probably damaging	Het
Cnn3	A	T	3: 121,451,935	E100V	probably damaging	Het
Col4a4	G	A	1: 82,497,860	R583C	unknown	Het
Commd7	A	C	2: 153,621,666		probably benign	Het
Csmd3	T	C	15: 48,457,503	T304A	probably benign	Het
Cyp4a14	A	T	4: 115,491,391	S325R	probably damaging	Het
D730048I06Rik	T	G	9: 35,789,743		probably benign	Het
Dclk2	T	C	3: 86,920,046	N42S	probably benign	Het
Dmrta1	A	T	4: 89,688,709	Q134L	probably damaging	Het
Dnaaf3	T	A	7: 4,523,801	I426L	probably benign	Het
Dnah17	G	A	11: 118,033,747	L3999F	probably damaging	Het
Dock6	A	G	9: 21,846,518	S97P	probably benign	Het
Dsg1a	T	A	18: 20,340,797	S976T	probably damaging	Het
Dstyk	T	A	1: 132,449,484	M29K	probably null	Het
Eif3i	A	T	4: 129,596,926	H18Q	probably benign	Het
Epm2a	A	G	10: 11,343,682	E71G	probably benign	Het
Eps15l1	A	T	8: 72,386,868	V260D	probably benign	Het
Faf1	A	G	4: 109,710,845	N34S	probably damaging	Het
Fat3	A	G	9: 16,246,719		probably null	Het
Fbxw10	T	A	11: 62,859,857	I422N	probably damaging	Het
Fkbp15	C	A	4: 62,327,899	G431W	probably damaging	Het
Flnb	A	C	14: 7,873,376	D224A	probably benign	Het
Flnc	G	A	6: 29,443,676	V566M	probably damaging	Het
Gatsl2	G	A	5: 134,136,153	C187Y	probably damaging	Het
Gli3	T	A	13: 15,725,549	S1174T	possibly damaging	Het
Glmn	A	T	5: 107,578,455	V93E	probably damaging	Het
Glrx2	T	C	1: 143,745,104	S74P	possibly damaging	Het
Gm13212	T	A	4: 145,624,233		probably benign	Het
Gm5422	G	A	10: 31,248,933		noncoding transcript	Het
Gpi1	T	C	7: 34,205,914	K362E	probably damaging	Het
Gtpbp2	T	C	17: 46,161,202	M21T	probably benign	Het
Gxylt1	A	G	15: 93,244,970	*405R	probably null	Het
Heyl	T	C	4: 123,246,083	V145A	probably damaging	Het
Hhipl1	A	C	12: 108,311,690	E92D	probably damaging	Het
Ifi207	A	G	1: 173,729,771	F467S	possibly damaging	Het
Inpp5b	A	T	4: 124,785,168		probably benign	Het
Kansl2	A	G	15: 98,529,397	I201T	probably damaging	Het
Kcnh8	T	C	17: 52,893,933	V465A	probably damaging	Het
Kcnu1	T	A	8: 25,851,900	I91N	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Klrc3	T	A	6: 129,641,538	Y94F	probably benign	Het
Lgals3bp	T	A	11: 118,393,287	T489S	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Magi1	T	C	6: 93,697,274	E951G	probably damaging	Het
Mcm7	T	C	5: 138,169,102	Q86R	probably damaging	Het
Med12l	G	T	3: 59,265,282		probably null	Het
Morc2a	A	G	11: 3,679,787	E402G	possibly damaging	Het
Mphosph8	T	C	14: 56,678,704	C486R	probably benign	Het
Mpo	A	G	11: 87,797,361	D282G	possibly damaging	Het
Mtcl1	G	T	17: 66,343,623	H1616N	probably benign	Het
Myh10	A	G	11: 68,807,289		probably benign	Het
Myh8	A	G	11: 67,292,876	E777G	probably damaging	Het
Nid1	A	G	13: 13,509,486	H1186R	probably benign	Het
Nppb	T	A	4: 147,985,997	S8T	probably benign	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Ntrk3	G	A	7: 78,477,935		probably benign	Het
Olfr1039	A	G	2: 86,131,261	V134A	possibly damaging	Het
Olfr1451	T	A	19: 12,999,038	D17E	probably benign	Het
Olfr308	C	T	7: 86,321,479	V158M	possibly damaging	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr356	A	G	2: 36,937,692	N191S	probably benign	Het
Olfr453	C	A	6: 42,744,135	L33M	possibly damaging	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Pard6g	T	C	18: 80,117,308	V212A	probably damaging	Het
Pdlim4	A	G	11: 54,063,737	L48S	possibly damaging	Het
Phactr3	T	C	2: 178,283,966	F345L	probably benign	Het
Plcb1	T	A	2: 135,325,667	Y460*	probably null	Het
Prcp	T	A	7: 92,901,280	V95D	probably benign	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Ror1	A	G	4: 100,410,025	N308D	probably benign	Het
Sdccag8	C	A	1: 176,955,889	Q655K	probably damaging	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Skap1	T	C	11: 96,464,733	I10T	possibly damaging	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Smad2	T	A	18: 76,288,084	C161*	probably null	Het
Spata31d1a	G	T	13: 59,701,043	D1090E	probably damaging	Het
Stard13	T	C	5: 151,045,168	Y879C	probably damaging	Het
Tdrd6	T	C	17: 43,624,833	T1775A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Terf1	A	G	1: 15,805,685	E3G	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tnfrsf26	C	T	7: 143,617,840		probably null	Het
Tor1aip1	A	C	1: 156,007,562	M180R	probably damaging	Het
Trabd2b	A	T	4: 114,610,008	Q478L	probably benign	Het
Trim41	C	A	11: 48,807,592	G516W	probably damaging	Het
Ttc30b	G	T	2: 75,936,785	H541Q	probably damaging	Het
Ttc39a	A	G	4: 109,442,706	Y464C	probably damaging	Het
Unc5a	A	G	13: 54,991,083	S92G	probably damaging	Het
Unc5d	A	C	8: 28,875,529	S143A	possibly damaging	Het
Usp34	A	T	11: 23,464,556	H2833L	possibly damaging	Het
Wdr17	T	G	8: 54,672,506	K446N	probably damaging	Het
Xirp2	A	T	2: 67,508,048	Q211L	possibly damaging	Het
Xkr7	G	A	2: 153,052,896	R256Q	probably benign	Het
Zfp236	T	C	18: 82,621,304	M1225V	probably benign	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp758	A	G	17: 22,375,970	H479R	probably damaging	Het
Zfp827	A	G	8: 79,185,721	N284S	possibly damaging	Het
Zfyve26	T	A	12: 79,268,434	I1423F	possibly damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGATGCAAGTAGTTCACCTCC -3'
(R):5'- ATGGTCTCTGGACAGCTAGG -3'

Sequencing Primer
(F):5'- GCAAGTAGTTCACCTCCTAACTAGTG -3'
(R):5'- CTCTGGACAGCTAGGTGATTCC -3'

Posted On

2014-10-01