Incidental Mutation 'R0195:Ccna1'
ID23347
Institutional Source Beutler Lab
Gene Symbol Ccna1
Ensembl Gene ENSMUSG00000027793
Gene Namecyclin A1
Synonyms
MMRRC Submission 038454-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0195 (G1)
Quality Score224
Status Validated
Chromosome3
Chromosomal Location55045469-55055501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55054364 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 45 (E45V)
Ref Sequence ENSEMBL: ENSMUSP00000143555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029368] [ENSMUST00000197238] [ENSMUST00000198102] [ENSMUST00000198320] [ENSMUST00000199144] [ENSMUST00000199352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029368
AA Change: E45V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029368
Gene: ENSMUSG00000027793
AA Change: E45V

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.8e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196588
Predicted Effect possibly damaging
Transcript: ENSMUST00000197238
AA Change: E45V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142692
Gene: ENSMUSG00000027793
AA Change: E45V

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.7e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198102
SMART Domains Protein: ENSMUSP00000142706
Gene: ENSMUSG00000027793

DomainStartEndE-ValueType
CYCLIN 57 141 1.5e-32 SMART
Cyclin_C 150 250 3.6e-10 SMART
CYCLIN 154 238 2.2e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198320
AA Change: E45V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143447
Gene: ENSMUSG00000027793
AA Change: E45V

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.7e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199144
AA Change: E45V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000199352
AA Change: E45V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199770
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.4%
Validation Efficiency 98% (156/160)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are infertile due to the arrest of spermatogenesis prior to the first meiotic division. Female mutant mice are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,512,974 R362P possibly damaging Het
Adam24 T A 8: 40,681,766 W758R probably benign Het
Adam26b G T 8: 43,520,270 T565K probably damaging Het
Adam7 T G 14: 68,527,627 probably benign Het
Adamts19 A G 18: 58,969,870 probably benign Het
Add1 A G 5: 34,610,646 probably benign Het
Ago1 A G 4: 126,463,691 C64R probably benign Het
Ankrd12 C T 17: 66,049,948 probably null Het
Arhgef33 A G 17: 80,381,434 K820E probably damaging Het
Arl9 T C 5: 77,006,494 V8A probably damaging Het
Aspm T C 1: 139,479,135 L1920P probably damaging Het
Atad2 A G 15: 58,099,954 probably benign Het
Atp2b2 A T 6: 113,793,874 V358E probably benign Het
C3ar1 A C 6: 122,851,155 C34W possibly damaging Het
C6 G A 15: 4,763,471 V353M probably benign Het
Capn7 T C 14: 31,365,581 I593T probably damaging Het
Casc3 T A 11: 98,821,493 D119E probably damaging Het
Cdc37 A G 9: 21,142,280 V180A probably benign Het
Cdh23 A G 10: 60,317,059 I2393T probably damaging Het
Cnbd1 T C 4: 18,906,988 probably benign Het
Cngb3 A T 4: 19,280,975 M15L probably benign Het
Crygn A G 5: 24,756,038 M90T possibly damaging Het
Cse1l T A 2: 166,940,088 S661R probably benign Het
D830013O20Rik C T 12: 73,364,321 noncoding transcript Het
Ddx24 C T 12: 103,418,961 probably null Het
Dnah3 A T 7: 120,077,775 probably null Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dnttip2 A T 3: 122,276,161 T342S probably benign Het
Evx2 G T 2: 74,659,044 R125S probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Git1 T A 11: 77,501,073 D240E probably benign Het
Glp2r T A 11: 67,709,708 K438N probably damaging Het
Gm4778 A G 3: 94,265,922 Y79C possibly damaging Het
Hivep1 T A 13: 42,156,153 I623N probably benign Het
Il17re A G 6: 113,466,137 E312G probably damaging Het
Itgb7 G A 15: 102,222,183 probably benign Het
Itpr3 A G 17: 27,114,114 Y1900C probably damaging Het
Krt2 G A 15: 101,813,191 Q472* probably null Het
Krtap5-1 A C 7: 142,296,697 C125G unknown Het
Macf1 A G 4: 123,434,916 S2554P probably damaging Het
March10 C T 11: 105,385,525 G646R probably damaging Het
Mrpl48 A C 7: 100,546,353 probably benign Het
Myo16 A T 8: 10,315,538 probably benign Het
Nrcam A T 12: 44,584,845 E1060D probably benign Het
Nsd3 T A 8: 25,680,693 C731S probably damaging Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Nxnl2 G T 13: 51,171,447 R42L probably damaging Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Orc1 C T 4: 108,614,308 R786* probably null Het
P2ry6 A T 7: 100,938,697 W152R probably damaging Het
Pex5l T C 3: 32,992,953 N283D possibly damaging Het
Pgk2 T C 17: 40,207,731 I269V probably benign Het
Phgdh T G 3: 98,316,550 probably benign Het
Pzp A T 6: 128,487,478 L1362Q probably damaging Het
Rbbp9 T C 2: 144,548,106 probably benign Het
Rffl A G 11: 82,810,163 L244P probably damaging Het
Serpina11 T C 12: 103,985,872 Y213C probably damaging Het
Srsf11 A G 3: 158,036,535 probably benign Het
Sspo T A 6: 48,486,636 V3785E probably benign Het
Svep1 A T 4: 58,089,514 S1632T possibly damaging Het
Tm4sf1 T A 3: 57,293,059 D74V probably damaging Het
Tmprss15 T A 16: 79,034,334 T393S probably benign Het
Tnfaip3 A G 10: 19,005,713 L275P probably damaging Het
Trim30c A G 7: 104,382,429 V393A probably benign Het
Tssk2 T A 16: 17,899,575 S281T probably benign Het
Tubb4a A G 17: 57,081,499 S176P probably damaging Het
Unc45b T A 11: 82,937,828 M785K probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn1r176 G T 7: 23,835,585 Q48K probably benign Het
Vmn2r110 A T 17: 20,574,055 L784Q probably benign Het
Vps13b A G 15: 35,471,899 T783A probably benign Het
Zfp800 A G 6: 28,243,847 M373T probably damaging Het
Zmym1 A G 4: 127,047,911 F895L possibly damaging Het
Other mutations in Ccna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccna1 APN 3 55050655 missense probably damaging 1.00
IGL00341:Ccna1 APN 3 55050655 missense probably damaging 1.00
IGL02484:Ccna1 APN 3 55048494 missense probably benign 0.08
IGL02649:Ccna1 APN 3 55054386 missense probably damaging 1.00
IGL03310:Ccna1 APN 3 55050620 missense probably benign 0.01
IGL03382:Ccna1 APN 3 55047277 missense probably damaging 1.00
R0127:Ccna1 UTSW 3 55049748 missense probably damaging 1.00
R0219:Ccna1 UTSW 3 55050927 missense probably benign 0.00
R0255:Ccna1 UTSW 3 55050628 missense probably damaging 1.00
R0492:Ccna1 UTSW 3 55048583 missense probably damaging 0.98
R1102:Ccna1 UTSW 3 55050860 missense probably damaging 1.00
R1378:Ccna1 UTSW 3 55049729 missense probably damaging 1.00
R3724:Ccna1 UTSW 3 55050932 missense probably damaging 0.99
R3799:Ccna1 UTSW 3 55050619 missense probably benign 0.24
R4199:Ccna1 UTSW 3 55047315 missense possibly damaging 0.85
R4992:Ccna1 UTSW 3 55049890 missense probably damaging 0.97
R5465:Ccna1 UTSW 3 55045644 missense probably benign 0.00
R5560:Ccna1 UTSW 3 55048569 missense probably damaging 1.00
R5603:Ccna1 UTSW 3 55050909 missense probably damaging 1.00
R6764:Ccna1 UTSW 3 55046078 missense probably damaging 1.00
R7034:Ccna1 UTSW 3 55046039 missense possibly damaging 0.67
R7144:Ccna1 UTSW 3 55045699 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGAACATCTTTCTGGCGGCTC -3'
(R):5'- TTTCCTGGATAGCAGCAGGCTGTG -3'

Sequencing Primer
(F):5'- tgcacacagatgcacacTATC -3'
(R):5'- TGGCTTACTAGGCAATGCATC -3'
Posted On2013-04-16