Incidental Mutation 'R2133:Abcb11'
ID 233490
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B member 11
Synonyms sister of P-glycoprotein, ABC16, PFIC2, Bsep, PGY4, Lith1
MMRRC Submission 040136-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.732) question?
Stock # R2133 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69068626-69172960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69154227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 113 (V113E)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect possibly damaging
Transcript: ENSMUST00000102709
AA Change: V113E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: V113E

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102710
AA Change: V113E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: V113E

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180142
AA Change: V113E

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: V113E

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,400,972 (GRCm39) K86E possibly damaging Het
Acacb TGGGG TGGG 5: 114,347,828 (GRCm39) probably null Het
Adgrb1 T A 15: 74,401,757 (GRCm39) L251Q probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Apc C A 18: 34,445,098 (GRCm39) Q665K possibly damaging Het
Atp13a2 T A 4: 140,732,327 (GRCm39) M864K probably damaging Het
Atp6v1c2 T C 12: 17,371,612 (GRCm39) T62A probably benign Het
Atp7b T C 8: 22,501,093 (GRCm39) T937A probably damaging Het
BC034090 C T 1: 155,101,532 (GRCm39) G244D probably benign Het
C2 G A 17: 35,098,878 (GRCm39) T146M probably damaging Het
Cacna1h A G 17: 25,602,502 (GRCm39) F1403L probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc141 G A 2: 76,889,951 (GRCm39) T447I probably benign Het
Cep164 T C 9: 45,714,481 (GRCm39) E182G probably damaging Het
Clstn3 T C 6: 124,426,462 (GRCm39) T575A probably benign Het
Cntnap2 T C 6: 47,275,379 (GRCm39) L1277P probably damaging Het
Cyp4a14 A T 4: 115,348,588 (GRCm39) S325R probably damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Ddx10 T A 9: 53,060,812 (GRCm39) R768S probably benign Het
Dis3 A T 14: 99,317,313 (GRCm39) N710K probably benign Het
Dmrta1 A T 4: 89,576,946 (GRCm39) Q134L probably damaging Het
Eif3i A T 4: 129,490,719 (GRCm39) H18Q probably benign Het
Emx2 A G 19: 59,452,465 (GRCm39) T250A probably damaging Het
Epb41l4a T C 18: 34,007,248 (GRCm39) T248A probably damaging Het
Epm2a A G 10: 11,219,426 (GRCm39) E71G probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Etv4 A G 11: 101,666,243 (GRCm39) I95T probably damaging Het
Etv6 T C 6: 134,225,717 (GRCm39) V316A possibly damaging Het
Exoc4 T C 6: 33,735,093 (GRCm39) V570A probably benign Het
Exoc4 T C 6: 33,887,473 (GRCm39) S754P probably benign Het
Faf1 A G 4: 109,568,042 (GRCm39) N34S probably damaging Het
Fam217a T C 13: 35,097,663 (GRCm39) H208R probably damaging Het
Fgf17 T C 14: 70,875,927 (GRCm39) R102G probably damaging Het
Fhad1 G A 4: 141,655,711 (GRCm39) R798C probably damaging Het
Fkbp15 C A 4: 62,246,136 (GRCm39) G431W probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm1587 A T 14: 78,032,296 (GRCm39) C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,255,059 (GRCm39) probably benign Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Guca2b T C 4: 119,514,828 (GRCm39) R78G probably benign Het
Helz T A 11: 107,561,310 (GRCm39) N775K unknown Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 TCC TCCACC 1: 135,314,013 (GRCm39) probably benign Het
Irak3 A G 10: 120,001,082 (GRCm39) I281T probably benign Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Khsrp A T 17: 57,334,832 (GRCm39) I138N probably benign Het
Larp1b T C 3: 40,924,970 (GRCm39) M149T possibly damaging Het
Ldhc A T 7: 46,519,023 (GRCm39) D82V probably damaging Het
Lgmn T C 12: 102,361,167 (GRCm39) Y400C probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpo T A 11: 87,711,956 (GRCm39) I34F probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mamld1 C A X: 70,162,998 (GRCm39) Q670K probably benign Het
Mcrs1 A T 15: 99,141,256 (GRCm39) D402E probably damaging Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Morc2a T A 11: 3,630,302 (GRCm39) C499* probably null Het
Mpp2 G A 11: 101,955,421 (GRCm39) R110C probably benign Het
Msra T A 14: 64,471,377 (GRCm39) T47S probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ogdhl T C 14: 32,047,891 (GRCm39) V47A probably benign Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or4a72 G A 2: 89,405,600 (GRCm39) Q157* probably null Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pkhd1l1 T C 15: 44,379,581 (GRCm39) I1069T possibly damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptprg T A 14: 12,211,637 (GRCm38) I198N probably damaging Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Rc3h2 A T 2: 37,268,928 (GRCm39) I846K probably benign Het
Ren1 C A 1: 133,286,720 (GRCm39) probably null Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Rnf157 A G 11: 116,249,520 (GRCm39) V232A possibly damaging Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ror1 A G 4: 100,267,222 (GRCm39) N308D probably benign Het
Rrp1 T C 10: 78,237,728 (GRCm39) probably benign Het
Rsph6a T A 7: 18,802,031 (GRCm39) V360E probably damaging Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc41a3 C T 6: 90,603,363 (GRCm39) A128V probably damaging Het
Slc7a9 T C 7: 35,152,918 (GRCm39) F112S probably damaging Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spidr G A 16: 15,871,137 (GRCm39) L278F probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Synpo T C 18: 60,735,967 (GRCm39) N421D probably damaging Het
Syt17 C T 7: 117,981,270 (GRCm39) G351S possibly damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem132a C A 19: 10,841,430 (GRCm39) R298L probably benign Het
Trabd2b A T 4: 114,467,205 (GRCm39) Q478L probably benign Het
Trappc12 A T 12: 28,796,597 (GRCm39) S312T probably benign Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Ttn G A 2: 76,680,956 (GRCm39) Q1044* probably null Het
Ugt2b34 C T 5: 87,054,416 (GRCm39) D122N probably benign Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zc3h6 A G 2: 128,809,750 (GRCm39) H9R possibly damaging Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp521 G A 18: 13,977,762 (GRCm39) P884S possibly damaging Het
Zfp64 A G 2: 168,782,663 (GRCm39) Y146H probably damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Zswim6 T A 13: 107,880,522 (GRCm39) noncoding transcript Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69,115,025 (GRCm39) missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69,076,288 (GRCm39) missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69,126,753 (GRCm39) missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69,117,936 (GRCm39) splice site probably benign
IGL01885:Abcb11 APN 2 69,117,971 (GRCm39) missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69,117,956 (GRCm39) missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69,073,842 (GRCm39) missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69,154,169 (GRCm39) splice site probably benign
IGL02119:Abcb11 APN 2 69,158,344 (GRCm39) critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69,087,654 (GRCm39) missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69,130,269 (GRCm39) missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69,079,233 (GRCm39) missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69,095,801 (GRCm39) nonsense probably null
IGL02505:Abcb11 APN 2 69,076,105 (GRCm39) missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69,136,949 (GRCm39) missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69,115,026 (GRCm39) missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69,122,343 (GRCm39) nonsense probably null
IGL03181:Abcb11 APN 2 69,158,352 (GRCm39) intron probably benign
3-1:Abcb11 UTSW 2 69,158,337 (GRCm39) missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69,073,862 (GRCm39) missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69,115,652 (GRCm39) missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69,117,010 (GRCm39) missense probably null 0.82
R0413:Abcb11 UTSW 2 69,158,355 (GRCm39) intron probably benign
R0437:Abcb11 UTSW 2 69,087,639 (GRCm39) missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69,108,228 (GRCm39) splice site probably benign
R0646:Abcb11 UTSW 2 69,115,627 (GRCm39) missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69,159,662 (GRCm39) missense probably benign 0.15
R0856:Abcb11 UTSW 2 69,154,262 (GRCm39) missense probably benign
R1061:Abcb11 UTSW 2 69,108,153 (GRCm39) missense probably benign 0.00
R1460:Abcb11 UTSW 2 69,087,718 (GRCm39) splice site probably benign
R1714:Abcb11 UTSW 2 69,136,925 (GRCm39) missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69,091,910 (GRCm39) missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69,076,267 (GRCm39) missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69,113,014 (GRCm39) splice site probably null
R2086:Abcb11 UTSW 2 69,089,820 (GRCm39) splice site probably benign
R2516:Abcb11 UTSW 2 69,159,673 (GRCm39) missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69,087,702 (GRCm39) missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3772:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3979:Abcb11 UTSW 2 69,154,320 (GRCm39) missense probably benign 0.11
R4227:Abcb11 UTSW 2 69,115,120 (GRCm39) missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69,136,949 (GRCm39) missense probably benign 0.03
R4614:Abcb11 UTSW 2 69,115,025 (GRCm39) missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69,115,615 (GRCm39) missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69,089,971 (GRCm39) missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69,154,306 (GRCm39) missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69,076,211 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69,069,540 (GRCm39) missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69,154,236 (GRCm39) missense probably benign 0.12
R5028:Abcb11 UTSW 2 69,104,356 (GRCm39) missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69,138,850 (GRCm39) missense probably benign 0.06
R5177:Abcb11 UTSW 2 69,115,639 (GRCm39) missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69,117,191 (GRCm39) missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69,076,108 (GRCm39) missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69,091,844 (GRCm39) missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69,073,811 (GRCm39) missense probably benign 0.43
R6252:Abcb11 UTSW 2 69,122,305 (GRCm39) missense probably benign 0.10
R6389:Abcb11 UTSW 2 69,154,238 (GRCm39) missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69,112,996 (GRCm39) missense probably benign
R6590:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69,117,190 (GRCm39) missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69,115,642 (GRCm39) missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69,096,019 (GRCm39) missense probably benign
R7223:Abcb11 UTSW 2 69,104,487 (GRCm39) missense probably benign
R7323:Abcb11 UTSW 2 69,117,979 (GRCm39) missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69,076,113 (GRCm39) missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69,117,963 (GRCm39) missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69,134,280 (GRCm39) critical splice donor site probably null
R7488:Abcb11 UTSW 2 69,108,146 (GRCm39) missense probably benign
R7544:Abcb11 UTSW 2 69,095,830 (GRCm39) missense probably benign 0.05
R7660:Abcb11 UTSW 2 69,117,938 (GRCm39) splice site probably null
R7754:Abcb11 UTSW 2 69,117,162 (GRCm39) missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69,069,535 (GRCm39) missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69,117,022 (GRCm39) missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69,115,068 (GRCm39) missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R7897:Abcb11 UTSW 2 69,154,216 (GRCm39) frame shift probably null
R7937:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R8004:Abcb11 UTSW 2 69,087,554 (GRCm39) missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69,104,383 (GRCm39) missense probably benign 0.09
R8279:Abcb11 UTSW 2 69,069,549 (GRCm39) missense probably benign 0.05
R8426:Abcb11 UTSW 2 69,155,606 (GRCm39) missense probably benign
R8441:Abcb11 UTSW 2 69,087,574 (GRCm39) missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69,154,381 (GRCm39) missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69,104,499 (GRCm39) missense probably benign
R8532:Abcb11 UTSW 2 69,090,035 (GRCm39) missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69,154,190 (GRCm39) missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69,095,856 (GRCm39) missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69,087,754 (GRCm39) intron probably benign
R8964:Abcb11 UTSW 2 69,117,061 (GRCm39) missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69,104,494 (GRCm39) missense
R9081:Abcb11 UTSW 2 69,122,388 (GRCm39) missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69,069,513 (GRCm39) missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69,138,809 (GRCm39) nonsense probably null
R9294:Abcb11 UTSW 2 69,095,840 (GRCm39) missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69,119,787 (GRCm39) missense probably benign 0.12
X0062:Abcb11 UTSW 2 69,076,250 (GRCm39) missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69,130,210 (GRCm39) missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69,122,325 (GRCm39) missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69,159,613 (GRCm39) critical splice donor site probably null
Z1177:Abcb11 UTSW 2 69,136,873 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTTGAAACCTGGAAGGATGG -3'
(R):5'- TCATCAAAAGACAACTGGCTGATG -3'

Sequencing Primer
(F):5'- CCTGGAAGGATGGAAATAGCTAC -3'
(R):5'- AAGACAACTGGCTGATGTTTATGG -3'
Posted On 2014-10-01