Incidental Mutation 'R2133:Insrr'
ID 233502
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
MMRRC Submission 040136-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.285) question?
Stock # R2133 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 87704258-87723408 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 87717879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably null
Transcript: ENSMUST00000029711
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107582
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,400,972 (GRCm39) K86E possibly damaging Het
Abcb11 A T 2: 69,154,227 (GRCm39) V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,347,828 (GRCm39) probably null Het
Adgrb1 T A 15: 74,401,757 (GRCm39) L251Q probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Apc C A 18: 34,445,098 (GRCm39) Q665K possibly damaging Het
Atp13a2 T A 4: 140,732,327 (GRCm39) M864K probably damaging Het
Atp6v1c2 T C 12: 17,371,612 (GRCm39) T62A probably benign Het
Atp7b T C 8: 22,501,093 (GRCm39) T937A probably damaging Het
BC034090 C T 1: 155,101,532 (GRCm39) G244D probably benign Het
C2 G A 17: 35,098,878 (GRCm39) T146M probably damaging Het
Cacna1h A G 17: 25,602,502 (GRCm39) F1403L probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc141 G A 2: 76,889,951 (GRCm39) T447I probably benign Het
Cep164 T C 9: 45,714,481 (GRCm39) E182G probably damaging Het
Clstn3 T C 6: 124,426,462 (GRCm39) T575A probably benign Het
Cntnap2 T C 6: 47,275,379 (GRCm39) L1277P probably damaging Het
Cyp4a14 A T 4: 115,348,588 (GRCm39) S325R probably damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Ddx10 T A 9: 53,060,812 (GRCm39) R768S probably benign Het
Dis3 A T 14: 99,317,313 (GRCm39) N710K probably benign Het
Dmrta1 A T 4: 89,576,946 (GRCm39) Q134L probably damaging Het
Eif3i A T 4: 129,490,719 (GRCm39) H18Q probably benign Het
Emx2 A G 19: 59,452,465 (GRCm39) T250A probably damaging Het
Epb41l4a T C 18: 34,007,248 (GRCm39) T248A probably damaging Het
Epm2a A G 10: 11,219,426 (GRCm39) E71G probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Etv4 A G 11: 101,666,243 (GRCm39) I95T probably damaging Het
Etv6 T C 6: 134,225,717 (GRCm39) V316A possibly damaging Het
Exoc4 T C 6: 33,735,093 (GRCm39) V570A probably benign Het
Exoc4 T C 6: 33,887,473 (GRCm39) S754P probably benign Het
Faf1 A G 4: 109,568,042 (GRCm39) N34S probably damaging Het
Fam217a T C 13: 35,097,663 (GRCm39) H208R probably damaging Het
Fgf17 T C 14: 70,875,927 (GRCm39) R102G probably damaging Het
Fhad1 G A 4: 141,655,711 (GRCm39) R798C probably damaging Het
Fkbp15 C A 4: 62,246,136 (GRCm39) G431W probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm1587 A T 14: 78,032,296 (GRCm39) C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,255,059 (GRCm39) probably benign Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Guca2b T C 4: 119,514,828 (GRCm39) R78G probably benign Het
Helz T A 11: 107,561,310 (GRCm39) N775K unknown Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 TCC TCCACC 1: 135,314,013 (GRCm39) probably benign Het
Irak3 A G 10: 120,001,082 (GRCm39) I281T probably benign Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Khsrp A T 17: 57,334,832 (GRCm39) I138N probably benign Het
Larp1b T C 3: 40,924,970 (GRCm39) M149T possibly damaging Het
Ldhc A T 7: 46,519,023 (GRCm39) D82V probably damaging Het
Lgmn T C 12: 102,361,167 (GRCm39) Y400C probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpo T A 11: 87,711,956 (GRCm39) I34F probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mamld1 C A X: 70,162,998 (GRCm39) Q670K probably benign Het
Mcrs1 A T 15: 99,141,256 (GRCm39) D402E probably damaging Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Morc2a T A 11: 3,630,302 (GRCm39) C499* probably null Het
Mpp2 G A 11: 101,955,421 (GRCm39) R110C probably benign Het
Msra T A 14: 64,471,377 (GRCm39) T47S probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ogdhl T C 14: 32,047,891 (GRCm39) V47A probably benign Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or4a72 G A 2: 89,405,600 (GRCm39) Q157* probably null Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pkhd1l1 T C 15: 44,379,581 (GRCm39) I1069T possibly damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptprg T A 14: 12,211,637 (GRCm38) I198N probably damaging Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Rc3h2 A T 2: 37,268,928 (GRCm39) I846K probably benign Het
Ren1 C A 1: 133,286,720 (GRCm39) probably null Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Rnf157 A G 11: 116,249,520 (GRCm39) V232A possibly damaging Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ror1 A G 4: 100,267,222 (GRCm39) N308D probably benign Het
Rrp1 T C 10: 78,237,728 (GRCm39) probably benign Het
Rsph6a T A 7: 18,802,031 (GRCm39) V360E probably damaging Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc41a3 C T 6: 90,603,363 (GRCm39) A128V probably damaging Het
Slc7a9 T C 7: 35,152,918 (GRCm39) F112S probably damaging Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spidr G A 16: 15,871,137 (GRCm39) L278F probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Synpo T C 18: 60,735,967 (GRCm39) N421D probably damaging Het
Syt17 C T 7: 117,981,270 (GRCm39) G351S possibly damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem132a C A 19: 10,841,430 (GRCm39) R298L probably benign Het
Trabd2b A T 4: 114,467,205 (GRCm39) Q478L probably benign Het
Trappc12 A T 12: 28,796,597 (GRCm39) S312T probably benign Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Ttn G A 2: 76,680,956 (GRCm39) Q1044* probably null Het
Ugt2b34 C T 5: 87,054,416 (GRCm39) D122N probably benign Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zc3h6 A G 2: 128,809,750 (GRCm39) H9R possibly damaging Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp521 G A 18: 13,977,762 (GRCm39) P884S possibly damaging Het
Zfp64 A G 2: 168,782,663 (GRCm39) Y146H probably damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Zswim6 T A 13: 107,880,522 (GRCm39) noncoding transcript Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87,720,981 (GRCm39) critical splice donor site probably null
IGL00801:Insrr APN 3 87,721,115 (GRCm39) missense probably damaging 1.00
IGL01628:Insrr APN 3 87,708,099 (GRCm39) nonsense probably null
IGL01755:Insrr APN 3 87,721,493 (GRCm39) missense probably damaging 1.00
IGL02100:Insrr APN 3 87,718,927 (GRCm39) missense probably damaging 1.00
IGL02261:Insrr APN 3 87,708,029 (GRCm39) missense probably damaging 1.00
IGL02366:Insrr APN 3 87,717,216 (GRCm39) missense possibly damaging 0.91
IGL02387:Insrr APN 3 87,720,434 (GRCm39) missense probably damaging 1.00
IGL02478:Insrr APN 3 87,716,719 (GRCm39) missense probably benign 0.14
IGL02550:Insrr APN 3 87,711,805 (GRCm39) missense probably damaging 1.00
IGL02555:Insrr APN 3 87,721,124 (GRCm39) missense probably damaging 0.99
IGL02673:Insrr APN 3 87,720,368 (GRCm39) missense possibly damaging 0.95
IGL02724:Insrr APN 3 87,716,879 (GRCm39) missense probably benign 0.31
IGL02798:Insrr APN 3 87,717,824 (GRCm39) missense probably damaging 1.00
IGL02969:Insrr APN 3 87,721,498 (GRCm39) nonsense probably null
IGL03073:Insrr APN 3 87,717,245 (GRCm39) splice site probably benign
IGL03178:Insrr APN 3 87,709,848 (GRCm39) splice site probably null
IGL03389:Insrr APN 3 87,716,038 (GRCm39) missense probably damaging 1.00
IGL03399:Insrr APN 3 87,716,638 (GRCm39) missense probably null 0.99
IGL02799:Insrr UTSW 3 87,720,888 (GRCm39) missense probably damaging 1.00
R0011:Insrr UTSW 3 87,716,923 (GRCm39) missense possibly damaging 0.86
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0357:Insrr UTSW 3 87,715,953 (GRCm39) splice site probably null
R0501:Insrr UTSW 3 87,717,991 (GRCm39) missense probably benign 0.12
R0504:Insrr UTSW 3 87,720,463 (GRCm39) missense possibly damaging 0.69
R0522:Insrr UTSW 3 87,708,179 (GRCm39) missense probably damaging 1.00
R0555:Insrr UTSW 3 87,721,744 (GRCm39) splice site probably benign
R0558:Insrr UTSW 3 87,718,288 (GRCm39) missense possibly damaging 0.77
R0599:Insrr UTSW 3 87,720,440 (GRCm39) missense probably damaging 0.97
R1312:Insrr UTSW 3 87,707,797 (GRCm39) missense probably damaging 1.00
R1694:Insrr UTSW 3 87,711,369 (GRCm39) missense probably benign
R1785:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1786:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1892:Insrr UTSW 3 87,721,184 (GRCm39) missense probably damaging 1.00
R1950:Insrr UTSW 3 87,721,820 (GRCm39) missense probably damaging 1.00
R2080:Insrr UTSW 3 87,721,598 (GRCm39) missense possibly damaging 0.79
R2094:Insrr UTSW 3 87,710,488 (GRCm39) missense probably damaging 1.00
R2130:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2131:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2220:Insrr UTSW 3 87,716,725 (GRCm39) missense probably damaging 1.00
R2259:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R2404:Insrr UTSW 3 87,709,974 (GRCm39) missense possibly damaging 0.71
R4027:Insrr UTSW 3 87,716,906 (GRCm39) missense probably benign
R4042:Insrr UTSW 3 87,721,134 (GRCm39) missense probably damaging 1.00
R4510:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4511:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4571:Insrr UTSW 3 87,708,194 (GRCm39) missense probably benign
R4870:Insrr UTSW 3 87,718,911 (GRCm39) missense probably damaging 1.00
R5057:Insrr UTSW 3 87,722,572 (GRCm39) missense probably benign 0.00
R5393:Insrr UTSW 3 87,718,007 (GRCm39) splice site probably null
R5685:Insrr UTSW 3 87,707,803 (GRCm39) splice site probably null
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6047:Insrr UTSW 3 87,711,483 (GRCm39) missense probably damaging 1.00
R6276:Insrr UTSW 3 87,707,826 (GRCm39) nonsense probably null
R6298:Insrr UTSW 3 87,720,272 (GRCm39) missense probably damaging 1.00
R6726:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6727:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6728:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6796:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R7041:Insrr UTSW 3 87,722,551 (GRCm39) missense probably damaging 1.00
R7169:Insrr UTSW 3 87,715,901 (GRCm39) missense probably benign 0.15
R7270:Insrr UTSW 3 87,710,440 (GRCm39) missense probably damaging 1.00
R7340:Insrr UTSW 3 87,721,623 (GRCm39) critical splice donor site probably null
R7398:Insrr UTSW 3 87,716,039 (GRCm39) missense probably damaging 1.00
R7473:Insrr UTSW 3 87,711,838 (GRCm39) splice site probably null
R7815:Insrr UTSW 3 87,716,002 (GRCm39) missense probably damaging 0.98
R8159:Insrr UTSW 3 87,707,735 (GRCm39) missense probably damaging 1.00
R8289:Insrr UTSW 3 87,721,501 (GRCm39) missense probably damaging 1.00
R8309:Insrr UTSW 3 87,717,749 (GRCm39) missense probably benign 0.00
R8312:Insrr UTSW 3 87,707,791 (GRCm39) missense possibly damaging 0.93
R8445:Insrr UTSW 3 87,720,891 (GRCm39) missense probably damaging 1.00
R8917:Insrr UTSW 3 87,718,276 (GRCm39) missense probably benign 0.00
R8960:Insrr UTSW 3 87,720,386 (GRCm39) missense probably damaging 1.00
R8989:Insrr UTSW 3 87,722,664 (GRCm39) missense probably damaging 0.96
R9015:Insrr UTSW 3 87,720,910 (GRCm39) missense probably damaging 1.00
R9202:Insrr UTSW 3 87,720,427 (GRCm39) missense probably damaging 1.00
R9251:Insrr UTSW 3 87,717,391 (GRCm39) missense probably benign 0.08
R9327:Insrr UTSW 3 87,721,604 (GRCm39) missense probably damaging 1.00
R9646:Insrr UTSW 3 87,721,805 (GRCm39) missense probably damaging 1.00
RF022:Insrr UTSW 3 87,711,792 (GRCm39) missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87,708,134 (GRCm39) missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87,709,886 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGAGGAACTGCTTGTGGC -3'
(R):5'- CGTCAGTCCAGGAACCATTG -3'

Sequencing Primer
(F):5'- GCCTATTTGCCAGACGCC -3'
(R):5'- ACGAGGTGGCCCGAACTTTAG -3'
Posted On 2014-10-01