Incidental Mutation 'R2133:Atp13a2'
ID233515
Institutional Source Beutler Lab
Gene Symbol Atp13a2
Ensembl Gene ENSMUSG00000036622
Gene NameATPase type 13A2
Synonyms
MMRRC Submission 040136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2133 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140986873-141007330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141005016 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 864 (M864K)
Ref Sequence ENSEMBL: ENSMUSP00000039648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]
Predicted Effect probably damaging
Transcript: ENSMUST00000037055
AA Change: M864K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622
AA Change: M864K

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 171 8.9e-27 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 497 3.6e-39 PFAM
Pfam:Hydrolase 502 785 2e-14 PFAM
Pfam:HAD 505 876 3.6e-27 PFAM
transmembrane domain 920 942 N/A INTRINSIC
transmembrane domain 957 979 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1033 1055 N/A INTRINSIC
transmembrane domain 1068 1090 N/A INTRINSIC
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127833
AA Change: M864K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622
AA Change: M864K

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 164 7.4e-29 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 496 6e-34 PFAM
Pfam:HAD 505 876 4e-27 PFAM
Pfam:Hydrolase 663 879 2.5e-15 PFAM
transmembrane domain 925 947 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
low complexity region 1102 1115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156995
Predicted Effect probably damaging
Transcript: ENSMUST00000168047
AA Change: M947K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: M947K

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 156 1e-27 PFAM
Cation_ATPase_N 262 334 9.78e-1 SMART
Pfam:E1-E2_ATPase 339 579 4.8e-34 PFAM
Pfam:HAD 588 959 3e-27 PFAM
Pfam:Hydrolase 726 962 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170797
Meta Mutation Damage Score 0.9282 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,452 K86E possibly damaging Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcb11 A T 2: 69,323,883 V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb1 T A 15: 74,529,908 L251Q probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Atp6v1c2 T C 12: 17,321,611 T62A probably benign Het
Atp7b T C 8: 22,011,077 T937A probably damaging Het
BC034090 C T 1: 155,225,786 G244D probably benign Het
C2 G A 17: 34,879,902 T146M probably damaging Het
Cacna1h A G 17: 25,383,528 F1403L probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc141 G A 2: 77,059,607 T447I probably benign Het
Cep164 T C 9: 45,803,183 E182G probably damaging Het
Clstn3 T C 6: 124,449,503 T575A probably benign Het
Cntnap2 T C 6: 47,298,445 L1277P probably damaging Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Ddx10 T A 9: 53,149,512 R768S probably benign Het
Dis3 A T 14: 99,079,877 N710K probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Emx2 A G 19: 59,464,033 T250A probably damaging Het
Epb41l4a T C 18: 33,874,195 T248A probably damaging Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Etv4 A G 11: 101,775,417 I95T probably damaging Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Exoc4 T C 6: 33,758,158 V570A probably benign Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fam217a T C 13: 34,913,680 H208R probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Fhad1 G A 4: 141,928,400 R798C probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm1587 A T 14: 77,794,856 C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Guca2b T C 4: 119,657,631 R78G probably benign Het
Helz T A 11: 107,670,484 N775K unknown Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCACC 1: 135,386,275 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irak3 A G 10: 120,165,177 I281T probably benign Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Khsrp A T 17: 57,027,832 I138N probably benign Het
Larp1b T C 3: 40,970,535 M149T possibly damaging Het
Ldhc A T 7: 46,869,599 D82V probably damaging Het
Lgmn T C 12: 102,394,908 Y400C probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpo T A 11: 87,821,130 I34F probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mamld1 C A X: 71,119,392 Q670K probably benign Het
Mcrs1 A T 15: 99,243,375 D402E probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Morc2a T A 11: 3,680,302 C499* probably null Het
Mpp2 G A 11: 102,064,595 R110C probably benign Het
Msra T A 14: 64,233,928 T47S probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ogdhl T C 14: 32,325,934 V47A probably benign Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr1245 G A 2: 89,575,256 Q157* probably null Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pkhd1l1 T C 15: 44,516,185 I1069T possibly damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptprg T A 14: 12,211,637 I198N probably damaging Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Rc3h2 A T 2: 37,378,916 I846K probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf157 A G 11: 116,358,694 V232A possibly damaging Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Rrp1 T C 10: 78,401,894 probably benign Het
Rsph6a T A 7: 19,068,106 V360E probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc41a3 C T 6: 90,626,381 A128V probably damaging Het
Slc7a9 T C 7: 35,453,493 F112S probably damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spidr G A 16: 16,053,273 L278F probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Synpo T C 18: 60,602,895 N421D probably damaging Het
Syt17 C T 7: 118,382,047 G351S possibly damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem132a C A 19: 10,864,066 R298L probably benign Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trappc12 A T 12: 28,746,598 S312T probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Ttn G A 2: 76,850,612 Q1044* probably null Het
Ugt2b34 C T 5: 86,906,557 D122N probably benign Het
Zc3h6 A G 2: 128,967,830 H9R possibly damaging Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp521 G A 18: 13,844,705 P884S possibly damaging Het
Zfp64 A G 2: 168,940,743 Y146H probably damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zswim6 T A 13: 107,743,987 noncoding transcript Het
Other mutations in Atp13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Atp13a2 APN 4 140992198 missense probably benign 0.02
IGL01476:Atp13a2 APN 4 141000770 missense probably damaging 1.00
IGL01980:Atp13a2 APN 4 141006152 missense probably benign 0.00
IGL02257:Atp13a2 APN 4 141006089 missense probably benign 0.00
IGL02589:Atp13a2 APN 4 141006411 missense probably damaging 1.00
IGL02936:Atp13a2 APN 4 141001949 missense probably benign 0.00
IGL03032:Atp13a2 APN 4 141000355 missense possibly damaging 0.95
IGL03040:Atp13a2 APN 4 141006173 missense probably damaging 1.00
IGL03271:Atp13a2 APN 4 141000397 missense possibly damaging 0.69
calla UTSW 4 140994332 nonsense probably null
eastern_moon UTSW 4 141005016 missense probably damaging 0.99
yucca_brevifolia UTSW 4 140993802 missense probably damaging 1.00
IGL03054:Atp13a2 UTSW 4 141006968 missense possibly damaging 0.83
PIT4469001:Atp13a2 UTSW 4 140994127 missense unknown
R0634:Atp13a2 UTSW 4 141006929 unclassified probably benign
R0881:Atp13a2 UTSW 4 141003931 missense probably damaging 1.00
R1295:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1296:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1472:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1780:Atp13a2 UTSW 4 141002460 missense possibly damaging 0.73
R1837:Atp13a2 UTSW 4 140994332 nonsense probably null
R1838:Atp13a2 UTSW 4 140994332 nonsense probably null
R1856:Atp13a2 UTSW 4 141004012 missense probably benign 0.43
R1918:Atp13a2 UTSW 4 140996371 missense possibly damaging 0.90
R1956:Atp13a2 UTSW 4 141004261 missense possibly damaging 0.92
R2126:Atp13a2 UTSW 4 140995391 missense possibly damaging 0.94
R2130:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2132:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2397:Atp13a2 UTSW 4 141003155 missense probably benign 0.00
R2873:Atp13a2 UTSW 4 141002983 missense probably benign 0.00
R3025:Atp13a2 UTSW 4 140994348 missense probably damaging 1.00
R3939:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3940:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3942:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R4247:Atp13a2 UTSW 4 140992228 critical splice donor site probably null
R4357:Atp13a2 UTSW 4 141001904 missense probably benign 0.01
R4406:Atp13a2 UTSW 4 141006476 missense probably damaging 1.00
R4686:Atp13a2 UTSW 4 141003276 critical splice donor site probably null
R5033:Atp13a2 UTSW 4 141000821 missense possibly damaging 0.91
R5066:Atp13a2 UTSW 4 141005138 missense probably damaging 1.00
R5278:Atp13a2 UTSW 4 141000818 missense probably damaging 0.97
R5464:Atp13a2 UTSW 4 141006070 missense probably damaging 1.00
R5522:Atp13a2 UTSW 4 141004360 splice site probably null
R5614:Atp13a2 UTSW 4 140992182 missense probably benign 0.35
R5846:Atp13a2 UTSW 4 140995596 missense possibly damaging 0.81
R6378:Atp13a2 UTSW 4 141007056 missense probably benign 0.34
R6512:Atp13a2 UTSW 4 141003218 missense probably damaging 1.00
R6518:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R6519:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R7166:Atp13a2 UTSW 4 141006984 missense possibly damaging 0.89
R7178:Atp13a2 UTSW 4 140999151 missense probably damaging 1.00
R7657:Atp13a2 UTSW 4 140992504 missense possibly damaging 0.92
Z1176:Atp13a2 UTSW 4 141005117 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAGATCTTGGGATCCATCC -3'
(R):5'- AGACAGGACATCAGCTGCTC -3'

Sequencing Primer
(F):5'- TCCCGAACACGGTAAAAGATCAGG -3'
(R):5'- TGCTCCAGCAGTGGACAG -3'
Posted On2014-10-01