Incidental Mutation 'R2133:Tecpr1'
ID 233521
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 040136-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2133 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144145463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 595 (T595S)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect probably benign
Transcript: ENSMUST00000085701
AA Change: T595S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: T595S

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156129
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,400,972 (GRCm39) K86E possibly damaging Het
Abcb11 A T 2: 69,154,227 (GRCm39) V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,347,828 (GRCm39) probably null Het
Adgrb1 T A 15: 74,401,757 (GRCm39) L251Q probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Apc C A 18: 34,445,098 (GRCm39) Q665K possibly damaging Het
Atp13a2 T A 4: 140,732,327 (GRCm39) M864K probably damaging Het
Atp6v1c2 T C 12: 17,371,612 (GRCm39) T62A probably benign Het
Atp7b T C 8: 22,501,093 (GRCm39) T937A probably damaging Het
BC034090 C T 1: 155,101,532 (GRCm39) G244D probably benign Het
C2 G A 17: 35,098,878 (GRCm39) T146M probably damaging Het
Cacna1h A G 17: 25,602,502 (GRCm39) F1403L probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc141 G A 2: 76,889,951 (GRCm39) T447I probably benign Het
Cep164 T C 9: 45,714,481 (GRCm39) E182G probably damaging Het
Clstn3 T C 6: 124,426,462 (GRCm39) T575A probably benign Het
Cntnap2 T C 6: 47,275,379 (GRCm39) L1277P probably damaging Het
Cyp4a14 A T 4: 115,348,588 (GRCm39) S325R probably damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Ddx10 T A 9: 53,060,812 (GRCm39) R768S probably benign Het
Dis3 A T 14: 99,317,313 (GRCm39) N710K probably benign Het
Dmrta1 A T 4: 89,576,946 (GRCm39) Q134L probably damaging Het
Eif3i A T 4: 129,490,719 (GRCm39) H18Q probably benign Het
Emx2 A G 19: 59,452,465 (GRCm39) T250A probably damaging Het
Epb41l4a T C 18: 34,007,248 (GRCm39) T248A probably damaging Het
Epm2a A G 10: 11,219,426 (GRCm39) E71G probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Etv4 A G 11: 101,666,243 (GRCm39) I95T probably damaging Het
Etv6 T C 6: 134,225,717 (GRCm39) V316A possibly damaging Het
Exoc4 T C 6: 33,735,093 (GRCm39) V570A probably benign Het
Exoc4 T C 6: 33,887,473 (GRCm39) S754P probably benign Het
Faf1 A G 4: 109,568,042 (GRCm39) N34S probably damaging Het
Fam217a T C 13: 35,097,663 (GRCm39) H208R probably damaging Het
Fgf17 T C 14: 70,875,927 (GRCm39) R102G probably damaging Het
Fhad1 G A 4: 141,655,711 (GRCm39) R798C probably damaging Het
Fkbp15 C A 4: 62,246,136 (GRCm39) G431W probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm1587 A T 14: 78,032,296 (GRCm39) C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,255,059 (GRCm39) probably benign Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Guca2b T C 4: 119,514,828 (GRCm39) R78G probably benign Het
Helz T A 11: 107,561,310 (GRCm39) N775K unknown Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 TCC TCCACC 1: 135,314,013 (GRCm39) probably benign Het
Irak3 A G 10: 120,001,082 (GRCm39) I281T probably benign Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Khsrp A T 17: 57,334,832 (GRCm39) I138N probably benign Het
Larp1b T C 3: 40,924,970 (GRCm39) M149T possibly damaging Het
Ldhc A T 7: 46,519,023 (GRCm39) D82V probably damaging Het
Lgmn T C 12: 102,361,167 (GRCm39) Y400C probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpo T A 11: 87,711,956 (GRCm39) I34F probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mamld1 C A X: 70,162,998 (GRCm39) Q670K probably benign Het
Mcrs1 A T 15: 99,141,256 (GRCm39) D402E probably damaging Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Morc2a T A 11: 3,630,302 (GRCm39) C499* probably null Het
Mpp2 G A 11: 101,955,421 (GRCm39) R110C probably benign Het
Msra T A 14: 64,471,377 (GRCm39) T47S probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ogdhl T C 14: 32,047,891 (GRCm39) V47A probably benign Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or4a72 G A 2: 89,405,600 (GRCm39) Q157* probably null Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pkhd1l1 T C 15: 44,379,581 (GRCm39) I1069T possibly damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptprg T A 14: 12,211,637 (GRCm38) I198N probably damaging Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Rc3h2 A T 2: 37,268,928 (GRCm39) I846K probably benign Het
Ren1 C A 1: 133,286,720 (GRCm39) probably null Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Rnf157 A G 11: 116,249,520 (GRCm39) V232A possibly damaging Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ror1 A G 4: 100,267,222 (GRCm39) N308D probably benign Het
Rrp1 T C 10: 78,237,728 (GRCm39) probably benign Het
Rsph6a T A 7: 18,802,031 (GRCm39) V360E probably damaging Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc41a3 C T 6: 90,603,363 (GRCm39) A128V probably damaging Het
Slc7a9 T C 7: 35,152,918 (GRCm39) F112S probably damaging Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spidr G A 16: 15,871,137 (GRCm39) L278F probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Synpo T C 18: 60,735,967 (GRCm39) N421D probably damaging Het
Syt17 C T 7: 117,981,270 (GRCm39) G351S possibly damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem132a C A 19: 10,841,430 (GRCm39) R298L probably benign Het
Trabd2b A T 4: 114,467,205 (GRCm39) Q478L probably benign Het
Trappc12 A T 12: 28,796,597 (GRCm39) S312T probably benign Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Ttn G A 2: 76,680,956 (GRCm39) Q1044* probably null Het
Ugt2b34 C T 5: 87,054,416 (GRCm39) D122N probably benign Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zc3h6 A G 2: 128,809,750 (GRCm39) H9R possibly damaging Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp521 G A 18: 13,977,762 (GRCm39) P884S possibly damaging Het
Zfp64 A G 2: 168,782,663 (GRCm39) Y146H probably damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Zswim6 T A 13: 107,880,522 (GRCm39) noncoding transcript Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144,153,776 (GRCm39) missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144,155,544 (GRCm39) missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144,137,658 (GRCm39) missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144,150,845 (GRCm39) intron probably benign
R8926:Tecpr1 UTSW 5 144,153,780 (GRCm39) missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCTTTAACCTTGGGACTGCC -3'
(R):5'- TCAAGGTGACTGTCAGACGG -3'

Sequencing Primer
(F):5'- AGCTGAAATGCTGAGTGCCC -3'
(R):5'- TGACTGTCAGACGGGCCATC -3'
Posted On 2014-10-01