Incidental Mutation 'R2133:Cntnap2'
ID 233526
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
MMRRC Submission 040136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2133 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47298445 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1277 (L1277P)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060839] [ENSMUST00000114641] [ENSMUST00000199100]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060839
AA Change: L53P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056299
Gene: ENSMUSG00000039419
AA Change: L53P

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
4.1m 59 77 4.21e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: L1277P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: L1277P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199100
AA Change: L53P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143528
Gene: ENSMUSG00000039419
AA Change: L53P

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
4.1m 59 77 4.21e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,452 K86E possibly damaging Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcb11 A T 2: 69,323,883 V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb1 T A 15: 74,529,908 L251Q probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atp6v1c2 T C 12: 17,321,611 T62A probably benign Het
Atp7b T C 8: 22,011,077 T937A probably damaging Het
BC034090 C T 1: 155,225,786 G244D probably benign Het
C2 G A 17: 34,879,902 T146M probably damaging Het
Cacna1h A G 17: 25,383,528 F1403L probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc141 G A 2: 77,059,607 T447I probably benign Het
Cep164 T C 9: 45,803,183 E182G probably damaging Het
Clstn3 T C 6: 124,449,503 T575A probably benign Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Ddx10 T A 9: 53,149,512 R768S probably benign Het
Dis3 A T 14: 99,079,877 N710K probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Emx2 A G 19: 59,464,033 T250A probably damaging Het
Epb41l4a T C 18: 33,874,195 T248A probably damaging Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Etv4 A G 11: 101,775,417 I95T probably damaging Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Exoc4 T C 6: 33,758,158 V570A probably benign Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fam217a T C 13: 34,913,680 H208R probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Fhad1 G A 4: 141,928,400 R798C probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm1587 A T 14: 77,794,856 C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Guca2b T C 4: 119,657,631 R78G probably benign Het
Helz T A 11: 107,670,484 N775K unknown Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCACC 1: 135,386,275 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irak3 A G 10: 120,165,177 I281T probably benign Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Khsrp A T 17: 57,027,832 I138N probably benign Het
Larp1b T C 3: 40,970,535 M149T possibly damaging Het
Ldhc A T 7: 46,869,599 D82V probably damaging Het
Lgmn T C 12: 102,394,908 Y400C probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpo T A 11: 87,821,130 I34F probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mamld1 C A X: 71,119,392 Q670K probably benign Het
Mcrs1 A T 15: 99,243,375 D402E probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Morc2a T A 11: 3,680,302 C499* probably null Het
Mpp2 G A 11: 102,064,595 R110C probably benign Het
Msra T A 14: 64,233,928 T47S probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ogdhl T C 14: 32,325,934 V47A probably benign Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr1245 G A 2: 89,575,256 Q157* probably null Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pkhd1l1 T C 15: 44,516,185 I1069T possibly damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptprg T A 14: 12,211,637 I198N probably damaging Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Rc3h2 A T 2: 37,378,916 I846K probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf157 A G 11: 116,358,694 V232A possibly damaging Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Rrp1 T C 10: 78,401,894 probably benign Het
Rsph6a T A 7: 19,068,106 V360E probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc41a3 C T 6: 90,626,381 A128V probably damaging Het
Slc7a9 T C 7: 35,453,493 F112S probably damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spidr G A 16: 16,053,273 L278F probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Synpo T C 18: 60,602,895 N421D probably damaging Het
Syt17 C T 7: 118,382,047 G351S possibly damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem132a C A 19: 10,864,066 R298L probably benign Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trappc12 A T 12: 28,746,598 S312T probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Ttn G A 2: 76,850,612 Q1044* probably null Het
Ugt2b34 C T 5: 86,906,557 D122N probably benign Het
Zc3h6 A G 2: 128,967,830 H9R possibly damaging Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp521 G A 18: 13,844,705 P884S possibly damaging Het
Zfp64 A G 2: 168,940,743 Y146H probably damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zswim6 T A 13: 107,743,987 noncoding transcript Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTCTGGAAGCCGACAGAAG -3'
(R):5'- GTGTGGCCATCAGTCTTAAGAG -3'

Sequencing Primer
(F):5'- CGACAGAAGCCATGTGTTACTTCTG -3'
(R):5'- TGGCCATCAGTCTTAAGAGTATTG -3'
Posted On 2014-10-01