Incidental Mutation 'R2133:9030624J02Rik'
ID233541
Institutional Source Beutler Lab
Gene Symbol 9030624J02Rik
Ensembl Gene ENSMUSG00000030982
Gene NameRIKEN cDNA 9030624J02 gene
Synonyms
MMRRC Submission 040136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2133 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location118740226-118842966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118794575 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 516 (Y516H)
Ref Sequence ENSEMBL: ENSMUSP00000102163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033280] [ENSMUST00000059390] [ENSMUST00000106552] [ENSMUST00000106553]
Predicted Effect probably damaging
Transcript: ENSMUST00000033280
AA Change: Y277H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000059390
AA Change: Y540H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051263
Gene: ENSMUSG00000030982
AA Change: Y540H

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106552
AA Change: Y449H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102162
Gene: ENSMUSG00000030982
AA Change: Y449H

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106553
AA Change: Y516H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102163
Gene: ENSMUSG00000030982
AA Change: Y516H

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149749
SMART Domains Protein: ENSMUSP00000121323
Gene: ENSMUSG00000030982

DomainStartEndE-ValueType
Pfam:Vps35 2 198 7.3e-10 PFAM
Meta Mutation Damage Score 0.5831 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,452 K86E possibly damaging Het
Abcb11 A T 2: 69,323,883 V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb1 T A 15: 74,529,908 L251Q probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atp6v1c2 T C 12: 17,321,611 T62A probably benign Het
Atp7b T C 8: 22,011,077 T937A probably damaging Het
BC034090 C T 1: 155,225,786 G244D probably benign Het
C2 G A 17: 34,879,902 T146M probably damaging Het
Cacna1h A G 17: 25,383,528 F1403L probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc141 G A 2: 77,059,607 T447I probably benign Het
Cep164 T C 9: 45,803,183 E182G probably damaging Het
Clstn3 T C 6: 124,449,503 T575A probably benign Het
Cntnap2 T C 6: 47,298,445 L1277P probably damaging Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Ddx10 T A 9: 53,149,512 R768S probably benign Het
Dis3 A T 14: 99,079,877 N710K probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Emx2 A G 19: 59,464,033 T250A probably damaging Het
Epb41l4a T C 18: 33,874,195 T248A probably damaging Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Etv4 A G 11: 101,775,417 I95T probably damaging Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Exoc4 T C 6: 33,758,158 V570A probably benign Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fam217a T C 13: 34,913,680 H208R probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Fhad1 G A 4: 141,928,400 R798C probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm1587 A T 14: 77,794,856 C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Guca2b T C 4: 119,657,631 R78G probably benign Het
Helz T A 11: 107,670,484 N775K unknown Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCACC 1: 135,386,275 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irak3 A G 10: 120,165,177 I281T probably benign Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Khsrp A T 17: 57,027,832 I138N probably benign Het
Larp1b T C 3: 40,970,535 M149T possibly damaging Het
Ldhc A T 7: 46,869,599 D82V probably damaging Het
Lgmn T C 12: 102,394,908 Y400C probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpo T A 11: 87,821,130 I34F probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mamld1 C A X: 71,119,392 Q670K probably benign Het
Mcrs1 A T 15: 99,243,375 D402E probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Morc2a T A 11: 3,680,302 C499* probably null Het
Mpp2 G A 11: 102,064,595 R110C probably benign Het
Msra T A 14: 64,233,928 T47S probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ogdhl T C 14: 32,325,934 V47A probably benign Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr1245 G A 2: 89,575,256 Q157* probably null Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pkhd1l1 T C 15: 44,516,185 I1069T possibly damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptprg T A 14: 12,211,637 I198N probably damaging Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Rc3h2 A T 2: 37,378,916 I846K probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf157 A G 11: 116,358,694 V232A possibly damaging Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Rrp1 T C 10: 78,401,894 probably benign Het
Rsph6a T A 7: 19,068,106 V360E probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc41a3 C T 6: 90,626,381 A128V probably damaging Het
Slc7a9 T C 7: 35,453,493 F112S probably damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spidr G A 16: 16,053,273 L278F probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Synpo T C 18: 60,602,895 N421D probably damaging Het
Syt17 C T 7: 118,382,047 G351S possibly damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem132a C A 19: 10,864,066 R298L probably benign Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trappc12 A T 12: 28,746,598 S312T probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Ttn G A 2: 76,850,612 Q1044* probably null Het
Ugt2b34 C T 5: 86,906,557 D122N probably benign Het
Zc3h6 A G 2: 128,967,830 H9R possibly damaging Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp521 G A 18: 13,844,705 P884S possibly damaging Het
Zfp64 A G 2: 168,940,743 Y146H probably damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zswim6 T A 13: 107,743,987 noncoding transcript Het
Other mutations in 9030624J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:9030624J02Rik APN 7 118797047 critical splice donor site probably null
IGL00229:9030624J02Rik APN 7 118804191 splice site probably benign
IGL01066:9030624J02Rik APN 7 118773011 splice site probably null
IGL01433:9030624J02Rik APN 7 118774051 splice site probably null
IGL02381:9030624J02Rik APN 7 118775375 missense probably damaging 1.00
IGL02566:9030624J02Rik APN 7 118752832 missense probably benign 0.04
IGL03199:9030624J02Rik APN 7 118766388 missense probably benign 0.18
IGL03224:9030624J02Rik APN 7 118792553 unclassified probably benign
R0535:9030624J02Rik UTSW 7 118748181 missense possibly damaging 0.95
R1109:9030624J02Rik UTSW 7 118775329 missense probably damaging 0.97
R1378:9030624J02Rik UTSW 7 118794572 nonsense probably null
R1378:9030624J02Rik UTSW 7 118794573 missense probably damaging 1.00
R1412:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R1474:9030624J02Rik UTSW 7 118760213 missense probably damaging 1.00
R1586:9030624J02Rik UTSW 7 118809972 missense probably damaging 1.00
R1785:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1786:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1921:9030624J02Rik UTSW 7 118833748 missense probably damaging 0.98
R1971:9030624J02Rik UTSW 7 118775334 missense probably damaging 1.00
R2038:9030624J02Rik UTSW 7 118811874 missense probably damaging 0.98
R2107:9030624J02Rik UTSW 7 118794539 unclassified probably benign
R2130:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2131:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2132:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2405:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R2411:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R3910:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3911:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3912:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3971:9030624J02Rik UTSW 7 118833799 missense probably damaging 0.98
R4697:9030624J02Rik UTSW 7 118791448 missense probably damaging 1.00
R4964:9030624J02Rik UTSW 7 118780268 missense possibly damaging 0.84
R4980:9030624J02Rik UTSW 7 118807009 missense probably damaging 1.00
R5034:9030624J02Rik UTSW 7 118791388 missense probably damaging 0.99
R5309:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5312:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5743:9030624J02Rik UTSW 7 118797011 missense possibly damaging 0.89
R6017:9030624J02Rik UTSW 7 118809921 missense probably damaging 1.00
R6089:9030624J02Rik UTSW 7 118746435 missense possibly damaging 0.76
R6320:9030624J02Rik UTSW 7 118753849 missense probably benign 0.08
R6415:9030624J02Rik UTSW 7 118792646 missense probably damaging 1.00
R6861:9030624J02Rik UTSW 7 118743675 missense probably damaging 1.00
R7034:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7036:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7339:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R7456:9030624J02Rik UTSW 7 118804117 missense probably benign 0.01
R7493:9030624J02Rik UTSW 7 118794577 utr 5 prime probably null
R8064:9030624J02Rik UTSW 7 118753924 missense probably damaging 1.00
X0028:9030624J02Rik UTSW 7 118800452 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATATTCCAACTGTCAGAGTCAGC -3'
(R):5'- CAGACCGTGACTTCTAAGAGC -3'

Sequencing Primer
(F):5'- GTCAGCCAGACAGTCTGTC -3'
(R):5'- ACCGTGACTTCTAAGAGCTGGAC -3'
Posted On2014-10-01