Mutagenetix > Incidental Mutation

Incidental Mutation 'R0195:Ago1'

23356

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

038454-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R0195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126463691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 64 (C64R)

Ref Sequence

ENSEMBL: ENSMUSP00000095498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably benign
Transcript: ENSMUST00000097888
AA Change: C64R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: C64R

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149425

Predicted Effect

probably benign
Transcript: ENSMUST00000176315

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Meta Mutation Damage Score

0.1482

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.4%

Validation Efficiency

98% (156/160)

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	C	G	11: 100,512,974	R362P	possibly damaging	Het
Adam24	T	A	8: 40,681,766	W758R	probably benign	Het
Adam26b	G	T	8: 43,520,270	T565K	probably damaging	Het
Adam7	T	G	14: 68,527,627		probably benign	Het
Adamts19	A	G	18: 58,969,870		probably benign	Het
Add1	A	G	5: 34,610,646		probably benign	Het
Ankrd12	C	T	17: 66,049,948		probably null	Het
Arhgef33	A	G	17: 80,381,434	K820E	probably damaging	Het
Arl9	T	C	5: 77,006,494	V8A	probably damaging	Het
Aspm	T	C	1: 139,479,135	L1920P	probably damaging	Het
Atad2	A	G	15: 58,099,954		probably benign	Het
Atp2b2	A	T	6: 113,793,874	V358E	probably benign	Het
C3ar1	A	C	6: 122,851,155	C34W	possibly damaging	Het
C6	G	A	15: 4,763,471	V353M	probably benign	Het
Capn7	T	C	14: 31,365,581	I593T	probably damaging	Het
Casc3	T	A	11: 98,821,493	D119E	probably damaging	Het
Ccna1	T	A	3: 55,054,364	E45V	probably damaging	Het
Cdc37	A	G	9: 21,142,280	V180A	probably benign	Het
Cdh23	A	G	10: 60,317,059	I2393T	probably damaging	Het
Cnbd1	T	C	4: 18,906,988		probably benign	Het
Cngb3	A	T	4: 19,280,975	M15L	probably benign	Het
Crygn	A	G	5: 24,756,038	M90T	possibly damaging	Het
Cse1l	T	A	2: 166,940,088	S661R	probably benign	Het
D830013O20Rik	C	T	12: 73,364,321		noncoding transcript	Het
Ddx24	C	T	12: 103,418,961		probably null	Het
Dnah3	A	T	7: 120,077,775		probably null	Het
Dnah9	C	T	11: 65,895,905	G3634E	probably benign	Het
Dnttip2	A	T	3: 122,276,161	T342S	probably benign	Het
Evx2	G	T	2: 74,659,044	R125S	probably damaging	Het
Fbxl5	A	T	5: 43,770,798	L40Q	probably damaging	Het
Git1	T	A	11: 77,501,073	D240E	probably benign	Het
Glp2r	T	A	11: 67,709,708	K438N	probably damaging	Het
Gm4778	A	G	3: 94,265,922	Y79C	possibly damaging	Het
Hivep1	T	A	13: 42,156,153	I623N	probably benign	Het
Il17re	A	G	6: 113,466,137	E312G	probably damaging	Het
Itgb7	G	A	15: 102,222,183		probably benign	Het
Itpr3	A	G	17: 27,114,114	Y1900C	probably damaging	Het
Krt2	G	A	15: 101,813,191	Q472*	probably null	Het
Krtap5-1	A	C	7: 142,296,697	C125G	unknown	Het
Macf1	A	G	4: 123,434,916	S2554P	probably damaging	Het
March10	C	T	11: 105,385,525	G646R	probably damaging	Het
Mrpl48	A	C	7: 100,546,353		probably benign	Het
Myo16	A	T	8: 10,315,538		probably benign	Het
Nrcam	A	T	12: 44,584,845	E1060D	probably benign	Het
Nsd3	T	A	8: 25,680,693	C731S	probably damaging	Het
Nup85	T	G	11: 115,564,531	M1R	probably null	Het
Nxnl2	G	T	13: 51,171,447	R42L	probably damaging	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Orc1	C	T	4: 108,614,308	R786*	probably null	Het
P2ry6	A	T	7: 100,938,697	W152R	probably damaging	Het
Pex5l	T	C	3: 32,992,953	N283D	possibly damaging	Het
Pgk2	T	C	17: 40,207,731	I269V	probably benign	Het
Phgdh	T	G	3: 98,316,550		probably benign	Het
Pzp	A	T	6: 128,487,478	L1362Q	probably damaging	Het
Rbbp9	T	C	2: 144,548,106		probably benign	Het
Rffl	A	G	11: 82,810,163	L244P	probably damaging	Het
Serpina11	T	C	12: 103,985,872	Y213C	probably damaging	Het
Srsf11	A	G	3: 158,036,535		probably benign	Het
Sspo	T	A	6: 48,486,636	V3785E	probably benign	Het
Svep1	A	T	4: 58,089,514	S1632T	possibly damaging	Het
Tm4sf1	T	A	3: 57,293,059	D74V	probably damaging	Het
Tmprss15	T	A	16: 79,034,334	T393S	probably benign	Het
Tnfaip3	A	G	10: 19,005,713	L275P	probably damaging	Het
Trim30c	A	G	7: 104,382,429	V393A	probably benign	Het
Tssk2	T	A	16: 17,899,575	S281T	probably benign	Het
Tubb4a	A	G	17: 57,081,499	S176P	probably damaging	Het
Unc45b	T	A	11: 82,937,828	M785K	probably damaging	Het
Vldlr	A	T	19: 27,238,386	D261V	probably damaging	Het
Vmn1r176	G	T	7: 23,835,585	Q48K	probably benign	Het
Vmn2r110	A	T	17: 20,574,055	L784Q	probably benign	Het
Vps13b	A	G	15: 35,471,899	T783A	probably benign	Het
Zfp800	A	G	6: 28,243,847	M373T	probably damaging	Het
Zmym1	A	G	4: 127,047,911	F895L	possibly damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTCTGTGCTCATGCACATCAGC -3'
(R):5'- TGAGTGTCTGAGCTAGTGGAAGCC -3'

Sequencing Primer
(F):5'- GCAAATATTAGACTATGCTCCGTGC -3'
(R):5'- TAGGAGACTGCCAGACTCTGTC -3'

Posted On

2013-04-16