Incidental Mutation 'R2133:Zfyve26'
ID233575
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Namezinc finger, FYVE domain containing 26
SynonymsA630028O16Rik, LOC380767, 9330197E15Rik
MMRRC Submission 040136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2133 (G1)
Quality Score170
Status Not validated
Chromosome12
Chromosomal Location79232346-79296304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79268434 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1423 (I1423F)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021547
AA Change: I1423F

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: I1423F

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219842
Predicted Effect probably benign
Transcript: ENSMUST00000219912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220262
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,452 K86E possibly damaging Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcb11 A T 2: 69,323,883 V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb1 T A 15: 74,529,908 L251Q probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atp6v1c2 T C 12: 17,321,611 T62A probably benign Het
Atp7b T C 8: 22,011,077 T937A probably damaging Het
BC034090 C T 1: 155,225,786 G244D probably benign Het
C2 G A 17: 34,879,902 T146M probably damaging Het
Cacna1h A G 17: 25,383,528 F1403L probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc141 G A 2: 77,059,607 T447I probably benign Het
Cep164 T C 9: 45,803,183 E182G probably damaging Het
Clstn3 T C 6: 124,449,503 T575A probably benign Het
Cntnap2 T C 6: 47,298,445 L1277P probably damaging Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Ddx10 T A 9: 53,149,512 R768S probably benign Het
Dis3 A T 14: 99,079,877 N710K probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Emx2 A G 19: 59,464,033 T250A probably damaging Het
Epb41l4a T C 18: 33,874,195 T248A probably damaging Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Etv4 A G 11: 101,775,417 I95T probably damaging Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Exoc4 T C 6: 33,758,158 V570A probably benign Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fam217a T C 13: 34,913,680 H208R probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Fhad1 G A 4: 141,928,400 R798C probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm1587 A T 14: 77,794,856 C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Guca2b T C 4: 119,657,631 R78G probably benign Het
Helz T A 11: 107,670,484 N775K unknown Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCACC 1: 135,386,275 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irak3 A G 10: 120,165,177 I281T probably benign Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Khsrp A T 17: 57,027,832 I138N probably benign Het
Larp1b T C 3: 40,970,535 M149T possibly damaging Het
Ldhc A T 7: 46,869,599 D82V probably damaging Het
Lgmn T C 12: 102,394,908 Y400C probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpo T A 11: 87,821,130 I34F probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mamld1 C A X: 71,119,392 Q670K probably benign Het
Mcrs1 A T 15: 99,243,375 D402E probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Morc2a T A 11: 3,680,302 C499* probably null Het
Mpp2 G A 11: 102,064,595 R110C probably benign Het
Msra T A 14: 64,233,928 T47S probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ogdhl T C 14: 32,325,934 V47A probably benign Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr1245 G A 2: 89,575,256 Q157* probably null Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pkhd1l1 T C 15: 44,516,185 I1069T possibly damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptprg T A 14: 12,211,637 I198N probably damaging Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Rc3h2 A T 2: 37,378,916 I846K probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf157 A G 11: 116,358,694 V232A possibly damaging Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Rrp1 T C 10: 78,401,894 probably benign Het
Rsph6a T A 7: 19,068,106 V360E probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc41a3 C T 6: 90,626,381 A128V probably damaging Het
Slc7a9 T C 7: 35,453,493 F112S probably damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spidr G A 16: 16,053,273 L278F probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Synpo T C 18: 60,602,895 N421D probably damaging Het
Syt17 C T 7: 118,382,047 G351S possibly damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem132a C A 19: 10,864,066 R298L probably benign Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trappc12 A T 12: 28,746,598 S312T probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Ttn G A 2: 76,850,612 Q1044* probably null Het
Ugt2b34 C T 5: 86,906,557 D122N probably benign Het
Zc3h6 A G 2: 128,967,830 H9R possibly damaging Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp521 G A 18: 13,844,705 P884S possibly damaging Het
Zfp64 A G 2: 168,940,743 Y146H probably damaging Het
Zswim6 T A 13: 107,743,987 noncoding transcript Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79249460 unclassified probably benign
IGL00940:Zfyve26 APN 12 79280900 missense probably benign
IGL01148:Zfyve26 APN 12 79260870 missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79252183 splice site probably null
IGL01472:Zfyve26 APN 12 79276343 missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79244373 missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79287851 missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79261574 splice site probably null
IGL01689:Zfyve26 APN 12 79284053 missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79287444 missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79244400 missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79276395 missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79268847 missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79280080 missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79239020 missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79263870 missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79261791 missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79295564 missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79284072 nonsense probably null
IGL02799:Zfyve26 UTSW 12 79273310 missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79276281 missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79244484 missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79246222 missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79268728 missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79265802 splice site probably benign
R0738:Zfyve26 UTSW 12 79295534 missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79273598 missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79272127 missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79263949 missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79274920 missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79282817 missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79252163 missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79252151 missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79287761 missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79238944 missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79278463 missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79269049 missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79286258 missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79264351 missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79239970 nonsense probably null
R1982:Zfyve26 UTSW 12 79255243 missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79284032 splice site probably null
R2071:Zfyve26 UTSW 12 79287446 missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79246052 missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79246087 missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79275040 missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79284116 missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79282799 splice site probably null
R3084:Zfyve26 UTSW 12 79265683 splice site probably benign
R3086:Zfyve26 UTSW 12 79265683 splice site probably benign
R4626:Zfyve26 UTSW 12 79269070 missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79244396 missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79249695 splice site probably null
R4926:Zfyve26 UTSW 12 79275011 missense probably benign
R4990:Zfyve26 UTSW 12 79287833 missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79280385 nonsense probably null
R5029:Zfyve26 UTSW 12 79286323 missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79255361 missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79280058 nonsense probably null
R5252:Zfyve26 UTSW 12 79268982 missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79270850 missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79246521 missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79239924 missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79273373 missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79264357 missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79287737 missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79266537 missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79293854 missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79268727 missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79249599 missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79282984 missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79240002 missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79238335 missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79266449 missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79284152 missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79279114 missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79280405 missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79268408 missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79246171 missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79278372 splice site probably null
R7299:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79251168 missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79240054 missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79287807 missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79268676 missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79290957 missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79268635 missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79280355 critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79255324 missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79268557 missense possibly damaging 0.79
R8190:Zfyve26 UTSW 12 79280836 missense probably benign 0.00
R8207:Zfyve26 UTSW 12 79260831 missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79255263 missense probably damaging 1.00
RF010:Zfyve26 UTSW 12 79255338 missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79239005 missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79268533 missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79287375 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTTACTGGTTCTAGACATCC -3'
(R):5'- TCTACAGCAAGCCTCTGAGC -3'

Sequencing Primer
(F):5'- GTGACGATGACTTGTGATCATACCAC -3'
(R):5'- TCTGAGCCAAAACAGAGTCTGGC -3'
Posted On2014-10-01