Incidental Mutation 'R2133:C2'
ID233595
Institutional Source Beutler Lab
Gene Symbol C2
Ensembl Gene ENSMUSG00000024371
Gene Namecomplement component 2 (within H-2S)
Synonymsclassical-complement pathway C3/C5 convertase
MMRRC Submission 040136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2133 (G1)
Quality Score220
Status Not validated
Chromosome17
Chromosomal Location34862604-34898265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34879902 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 146 (T146M)
Ref Sequence ENSEMBL: ENSMUSP00000025230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025230] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000173093]
Predicted Effect probably damaging
Transcript: ENSMUST00000025230
AA Change: T146M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371
AA Change: T146M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130728
Predicted Effect probably benign
Transcript: ENSMUST00000146299
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173093
SMART Domains Protein: ENSMUSP00000133903
Gene: ENSMUSG00000049823

DomainStartEndE-ValueType
Pfam:BTB 23 68 2e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes component C2 of the classical pathway of the complement system. The encoded protein undergoes proteolytic processing mediated by component C1 resulting in C2a and C2b fragments. C2a fragment, in turn, selectively cleaves components C3 and C5 of the complement system. Mice lacking the encoded protein are found to be more susceptible to bacterial infections. Mutations in the human homolog of this gene are associated with disorders such as systemic lupus erythematosus, Henoch-Schonlein purpura, or polymyositis. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,452 K86E possibly damaging Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcb11 A T 2: 69,323,883 V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb1 T A 15: 74,529,908 L251Q probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atp6v1c2 T C 12: 17,321,611 T62A probably benign Het
Atp7b T C 8: 22,011,077 T937A probably damaging Het
BC034090 C T 1: 155,225,786 G244D probably benign Het
Cacna1h A G 17: 25,383,528 F1403L probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc141 G A 2: 77,059,607 T447I probably benign Het
Cep164 T C 9: 45,803,183 E182G probably damaging Het
Clstn3 T C 6: 124,449,503 T575A probably benign Het
Cntnap2 T C 6: 47,298,445 L1277P probably damaging Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Ddx10 T A 9: 53,149,512 R768S probably benign Het
Dis3 A T 14: 99,079,877 N710K probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Emx2 A G 19: 59,464,033 T250A probably damaging Het
Epb41l4a T C 18: 33,874,195 T248A probably damaging Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Etv4 A G 11: 101,775,417 I95T probably damaging Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Exoc4 T C 6: 33,758,158 V570A probably benign Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fam217a T C 13: 34,913,680 H208R probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Fhad1 G A 4: 141,928,400 R798C probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm1587 A T 14: 77,794,856 C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Guca2b T C 4: 119,657,631 R78G probably benign Het
Helz T A 11: 107,670,484 N775K unknown Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCACC 1: 135,386,275 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irak3 A G 10: 120,165,177 I281T probably benign Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Khsrp A T 17: 57,027,832 I138N probably benign Het
Larp1b T C 3: 40,970,535 M149T possibly damaging Het
Ldhc A T 7: 46,869,599 D82V probably damaging Het
Lgmn T C 12: 102,394,908 Y400C probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpo T A 11: 87,821,130 I34F probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mamld1 C A X: 71,119,392 Q670K probably benign Het
Mcrs1 A T 15: 99,243,375 D402E probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Morc2a T A 11: 3,680,302 C499* probably null Het
Mpp2 G A 11: 102,064,595 R110C probably benign Het
Msra T A 14: 64,233,928 T47S probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ogdhl T C 14: 32,325,934 V47A probably benign Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr1245 G A 2: 89,575,256 Q157* probably null Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pkhd1l1 T C 15: 44,516,185 I1069T possibly damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptprg T A 14: 12,211,637 I198N probably damaging Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Rc3h2 A T 2: 37,378,916 I846K probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf157 A G 11: 116,358,694 V232A possibly damaging Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Rrp1 T C 10: 78,401,894 probably benign Het
Rsph6a T A 7: 19,068,106 V360E probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc41a3 C T 6: 90,626,381 A128V probably damaging Het
Slc7a9 T C 7: 35,453,493 F112S probably damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spidr G A 16: 16,053,273 L278F probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Synpo T C 18: 60,602,895 N421D probably damaging Het
Syt17 C T 7: 118,382,047 G351S possibly damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem132a C A 19: 10,864,066 R298L probably benign Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trappc12 A T 12: 28,746,598 S312T probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Ttn G A 2: 76,850,612 Q1044* probably null Het
Ugt2b34 C T 5: 86,906,557 D122N probably benign Het
Zc3h6 A G 2: 128,967,830 H9R possibly damaging Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp521 G A 18: 13,844,705 P884S possibly damaging Het
Zfp64 A G 2: 168,940,743 Y146H probably damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zswim6 T A 13: 107,743,987 noncoding transcript Het
Other mutations in C2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:C2 APN 17 34866563 missense probably damaging 1.00
IGL02249:C2 APN 17 34864508 unclassified probably benign
IGL02568:C2 APN 17 34864349 missense possibly damaging 0.50
IGL03013:C2 APN 17 34872459 missense probably damaging 0.98
R0142:C2 UTSW 17 34873528 missense possibly damaging 0.53
R0619:C2 UTSW 17 34872503 missense probably damaging 1.00
R1401:C2 UTSW 17 34872481 missense possibly damaging 0.71
R1639:C2 UTSW 17 34872403 missense probably benign 0.02
R1808:C2 UTSW 17 34864532 missense probably damaging 1.00
R2860:C2 UTSW 17 34863878 missense possibly damaging 0.94
R2861:C2 UTSW 17 34863878 missense possibly damaging 0.94
R3882:C2 UTSW 17 34873489 missense probably benign 0.00
R4571:C2 UTSW 17 34863659 missense probably benign 0.00
R4622:C2 UTSW 17 34863674 missense probably damaging 0.99
R5611:C2 UTSW 17 34872384 missense probably damaging 0.99
R5767:C2 UTSW 17 34876456 missense possibly damaging 0.58
R6327:C2 UTSW 17 34864103 missense probably benign 0.41
R6448:C2 UTSW 17 34863359 missense possibly damaging 0.67
R6518:C2 UTSW 17 34864118 missense probably damaging 1.00
R6929:C2 UTSW 17 34864347 missense possibly damaging 0.68
R7324:C2 UTSW 17 34881688 missense probably benign 0.13
R7446:C2 UTSW 17 34876010 missense probably damaging 1.00
R7456:C2 UTSW 17 34864582 missense probably damaging 1.00
R7479:C2 UTSW 17 34863465 missense probably damaging 1.00
R7807:C2 UTSW 17 34876371 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACCTAGACATGCTCCTAGCC -3'
(R):5'- CAACTGTAGCTGTGGTGTCAAC -3'

Sequencing Primer
(F):5'- TCCTAGCCGGTCAGTGATG -3'
(R):5'- GTGTCAACCACCCTCCG -3'
Posted On2014-10-01