Incidental Mutation 'R2133:Zfp521'
ID233601
Institutional Source Beutler Lab
Gene Symbol Zfp521
Ensembl Gene ENSMUSG00000024420
Gene Namezinc finger protein 521
SynonymsB930086A16Rik, Evi3
MMRRC Submission 040136-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R2133 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location13687013-13972733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13844705 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 884 (P884S)
Ref Sequence ENSEMBL: ENSMUSP00000025288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025288
AA Change: P884S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025288
Gene: ENSMUSG00000024420
AA Change: P884S

DomainStartEndE-ValueType
ZnF_C2H2 47 68 3.47e1 SMART
low complexity region 82 100 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
ZnF_C2H2 118 140 3.89e-3 SMART
ZnF_C2H2 146 168 1.33e-1 SMART
ZnF_C2H2 174 196 1.38e-3 SMART
ZnF_C2H2 202 224 2.36e-2 SMART
ZnF_C2H2 246 269 6.57e-1 SMART
ZnF_C2H2 281 304 3.52e-1 SMART
ZnF_C2H2 310 332 1.76e-1 SMART
low complexity region 345 358 N/A INTRINSIC
ZnF_C2H2 405 429 4.34e-1 SMART
ZnF_C2H2 437 460 6.23e-2 SMART
ZnF_C2H2 477 500 8.94e-3 SMART
ZnF_C2H2 513 536 5.42e-2 SMART
ZnF_C2H2 560 585 1.86e0 SMART
ZnF_C2H2 634 656 1.12e-3 SMART
ZnF_C2H2 664 686 2.12e-4 SMART
ZnF_C2H2 694 717 6.42e-4 SMART
ZnF_C2H2 722 745 7.78e-3 SMART
ZnF_C2H2 752 775 6.32e-3 SMART
ZnF_C2H2 783 805 2.05e-2 SMART
ZnF_C2H2 809 832 4.72e-2 SMART
ZnF_C2H2 886 909 1.86e0 SMART
ZnF_C2H2 930 952 3.04e-5 SMART
ZnF_C2H2 959 981 6.42e-4 SMART
ZnF_C2H2 988 1010 7.49e0 SMART
ZnF_C2H2 1020 1042 4.99e1 SMART
Blast:RING 1067 1098 1e-9 BLAST
low complexity region 1099 1119 N/A INTRINSIC
ZnF_C2H2 1138 1161 1.79e-2 SMART
ZnF_C2H2 1195 1217 2.53e-2 SMART
ZnF_C2H2 1225 1247 2.32e-1 SMART
ZnF_C2H2 1256 1279 2.91e-2 SMART
ZnF_C2H2 1286 1309 5.72e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal growth retardation, behavioral anomalies including hyperlocomotion, lower anxiety, higher impulsivity and impaired learning, abnormal formation of the neuronal cell layers of the dentate gyrus in the hippocampus, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,452 K86E possibly damaging Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
Abcb11 A T 2: 69,323,883 V113E possibly damaging Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb1 T A 15: 74,529,908 L251Q probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atp6v1c2 T C 12: 17,321,611 T62A probably benign Het
Atp7b T C 8: 22,011,077 T937A probably damaging Het
BC034090 C T 1: 155,225,786 G244D probably benign Het
C2 G A 17: 34,879,902 T146M probably damaging Het
Cacna1h A G 17: 25,383,528 F1403L probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc141 G A 2: 77,059,607 T447I probably benign Het
Cep164 T C 9: 45,803,183 E182G probably damaging Het
Clstn3 T C 6: 124,449,503 T575A probably benign Het
Cntnap2 T C 6: 47,298,445 L1277P probably damaging Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Ddx10 T A 9: 53,149,512 R768S probably benign Het
Dis3 A T 14: 99,079,877 N710K probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Emx2 A G 19: 59,464,033 T250A probably damaging Het
Epb41l4a T C 18: 33,874,195 T248A probably damaging Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Etv4 A G 11: 101,775,417 I95T probably damaging Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Exoc4 T C 6: 33,758,158 V570A probably benign Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fam217a T C 13: 34,913,680 H208R probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Fhad1 G A 4: 141,928,400 R798C probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm1587 A T 14: 77,794,856 C113* probably null Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Guca2b T C 4: 119,657,631 R78G probably benign Het
Helz T A 11: 107,670,484 N775K unknown Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCACC 1: 135,386,275 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irak3 A G 10: 120,165,177 I281T probably benign Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Khsrp A T 17: 57,027,832 I138N probably benign Het
Larp1b T C 3: 40,970,535 M149T possibly damaging Het
Ldhc A T 7: 46,869,599 D82V probably damaging Het
Lgmn T C 12: 102,394,908 Y400C probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpo T A 11: 87,821,130 I34F probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mamld1 C A X: 71,119,392 Q670K probably benign Het
Mcrs1 A T 15: 99,243,375 D402E probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Morc2a T A 11: 3,680,302 C499* probably null Het
Mpp2 G A 11: 102,064,595 R110C probably benign Het
Msra T A 14: 64,233,928 T47S probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ogdhl T C 14: 32,325,934 V47A probably benign Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr1245 G A 2: 89,575,256 Q157* probably null Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pkhd1l1 T C 15: 44,516,185 I1069T possibly damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptprg T A 14: 12,211,637 I198N probably damaging Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Rc3h2 A T 2: 37,378,916 I846K probably benign Het
Ren1 C A 1: 133,358,982 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf157 A G 11: 116,358,694 V232A possibly damaging Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Rrp1 T C 10: 78,401,894 probably benign Het
Rsph6a T A 7: 19,068,106 V360E probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc41a3 C T 6: 90,626,381 A128V probably damaging Het
Slc7a9 T C 7: 35,453,493 F112S probably damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spidr G A 16: 16,053,273 L278F probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Synpo T C 18: 60,602,895 N421D probably damaging Het
Syt17 C T 7: 118,382,047 G351S possibly damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem132a C A 19: 10,864,066 R298L probably benign Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trappc12 A T 12: 28,746,598 S312T probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Ttn G A 2: 76,850,612 Q1044* probably null Het
Ugt2b34 C T 5: 86,906,557 D122N probably benign Het
Zc3h6 A G 2: 128,967,830 H9R possibly damaging Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp64 A G 2: 168,940,743 Y146H probably damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zswim6 T A 13: 107,743,987 noncoding transcript Het
Other mutations in Zfp521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Zfp521 APN 18 13846502 missense probably benign 0.15
IGL00499:Zfp521 APN 18 13939120 missense probably benign 0.25
IGL01291:Zfp521 APN 18 13817246 missense probably damaging 1.00
IGL01335:Zfp521 APN 18 13844719 missense probably benign 0.31
IGL01384:Zfp521 APN 18 13843923 missense probably benign 0.26
IGL01520:Zfp521 APN 18 13938988 missense possibly damaging 0.92
IGL02248:Zfp521 APN 18 13844246 missense possibly damaging 0.93
IGL02640:Zfp521 APN 18 13844930 missense probably benign 0.00
ANU05:Zfp521 UTSW 18 13817246 missense probably damaging 1.00
R0113:Zfp521 UTSW 18 13845091 missense probably damaging 1.00
R0197:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R0457:Zfp521 UTSW 18 13844840 missense probably benign
R0494:Zfp521 UTSW 18 13845268 missense probably damaging 1.00
R0494:Zfp521 UTSW 18 13846870 missense probably damaging 1.00
R0883:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R2263:Zfp521 UTSW 18 13846240 missense possibly damaging 0.89
R3699:Zfp521 UTSW 18 13846273 nonsense probably null
R3760:Zfp521 UTSW 18 13844629 missense possibly damaging 0.93
R3851:Zfp521 UTSW 18 13717751 splice site probably benign
R3950:Zfp521 UTSW 18 13846346 missense probably damaging 0.99
R4398:Zfp521 UTSW 18 13846544 missense probably benign 0.26
R4583:Zfp521 UTSW 18 13844330 missense probably benign 0.19
R4688:Zfp521 UTSW 18 13844590 missense probably damaging 1.00
R4688:Zfp521 UTSW 18 13844591 nonsense probably null
R4698:Zfp521 UTSW 18 13845603 missense probably damaging 0.96
R4738:Zfp521 UTSW 18 13844054 missense possibly damaging 0.50
R5031:Zfp521 UTSW 18 13844273 missense possibly damaging 0.68
R5137:Zfp521 UTSW 18 13845448 missense probably damaging 1.00
R5257:Zfp521 UTSW 18 13846978 missense probably damaging 1.00
R5420:Zfp521 UTSW 18 13844087 missense probably damaging 1.00
R5917:Zfp521 UTSW 18 13845555 missense probably damaging 0.98
R5995:Zfp521 UTSW 18 13717624 missense probably damaging 1.00
R6088:Zfp521 UTSW 18 13846109 missense possibly damaging 0.47
R6150:Zfp521 UTSW 18 13844078 missense probably damaging 1.00
R6261:Zfp521 UTSW 18 13844627 missense probably damaging 1.00
R7649:Zfp521 UTSW 18 13844356 missense probably damaging 1.00
R7662:Zfp521 UTSW 18 13844116 missense probably damaging 1.00
R7774:Zfp521 UTSW 18 13845781 missense probably benign 0.41
Z1176:Zfp521 UTSW 18 13715163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGTTCTCGAGCAAACG -3'
(R):5'- AAGAAGTACAACTGCAGGTTCTG -3'

Sequencing Primer
(F):5'- GGTTCTCGAGCAAACGTTACACTTG -3'
(R):5'- AGGTTCTGCAGCAAAGCCTTC -3'
Posted On2014-10-01