Incidental Mutation 'R2134:Cenpf'
ID233613
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission 040137-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R2134 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 189658642 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 998 (N998D)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165962
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171929
AA Change: N998D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: N998D

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Ces2e T A 8: 104,932,539 probably null Het
Chd7 A G 4: 8,753,147 Q548R probably damaging Het
Chfr T A 5: 110,144,761 probably null Het
Clu A G 14: 65,974,841 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Ddx47 G T 6: 135,015,350 E113* probably null Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fastk T C 5: 24,445,141 R3G probably damaging Het
Fxr1 A T 3: 34,058,047 E367D probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Terf2ip T C 8: 112,011,639 V53A possibly damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vmn2r114 T A 17: 23,291,763 Y581F probably damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
R7353:Cenpf UTSW 1 189654138 nonsense probably null
R7402:Cenpf UTSW 1 189659378 nonsense probably null
R7460:Cenpf UTSW 1 189654050 missense probably damaging 0.97
R7484:Cenpf UTSW 1 189656821 missense probably damaging 1.00
R7574:Cenpf UTSW 1 189658667 missense probably damaging 1.00
R7691:Cenpf UTSW 1 189658207 nonsense probably null
R7698:Cenpf UTSW 1 189662072 missense probably benign 0.01
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCTGAGCATGCATTCTAAC -3'
(R):5'- AGCTCAGCAAACAGAGGTTC -3'

Sequencing Primer
(F):5'- GCTGAGCATGCATTCTAACTTAGC -3'
(R):5'- CTCAGCAAACAGAGGTTCAAAAG -3'
Posted On2014-10-01