Incidental Mutation 'R2134:Chd7'
ID233619
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Namechromodomain helicase DNA binding protein 7
SynonymsA730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
MMRRC Submission 040137-MU
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2134 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location8690406-8867659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8753147 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 548 (Q548R)
Ref Sequence ENSEMBL: ENSMUSP00000118711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000127476] [ENSMUST00000129655] [ENSMUST00000170391]
Predicted Effect unknown
Transcript: ENSMUST00000039267
AA Change: Q548R
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: Q548R

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000051558
AA Change: Q548R
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: Q548R

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127476
AA Change: Q548R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118711
Gene: ENSMUSG00000041235
AA Change: Q548R

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
Blast:CHROMO 596 630 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129655
Predicted Effect unknown
Transcript: ENSMUST00000170391
AA Change: Q548R
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235
AA Change: Q548R

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170457
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Cenpf T C 1: 189,658,642 N998D probably benign Het
Ces2e T A 8: 104,932,539 probably null Het
Chfr T A 5: 110,144,761 probably null Het
Clu A G 14: 65,974,841 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Ddx47 G T 6: 135,015,350 E113* probably null Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fastk T C 5: 24,445,141 R3G probably damaging Het
Fxr1 A T 3: 34,058,047 E367D probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Terf2ip T C 8: 112,011,639 V53A possibly damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vmn2r114 T A 17: 23,291,763 Y581F probably damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8828398 missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0388:Chd7 UTSW 4 8854560 missense probably benign 0.27
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0799:Chd7 UTSW 4 8801310 intron probably benign
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1605:Chd7 UTSW 4 8844675 missense probably damaging 1.00
R1693:Chd7 UTSW 4 8864307 critical splice donor site probably null
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8844417 missense probably damaging 1.00
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
R7288:Chd7 UTSW 4 8847093 missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8752196 missense unknown
R7452:Chd7 UTSW 4 8854731 missense probably benign 0.03
R7471:Chd7 UTSW 4 8859197 missense probably damaging 0.96
R7588:Chd7 UTSW 4 8864039 missense probably damaging 1.00
R7711:Chd7 UTSW 4 8805234 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGATACCTGGCCAACAGC -3'
(R):5'- TTCTAACCAGTGGACCTAGGCTC -3'

Sequencing Primer
(F):5'- ACAGCACCCTGGTCAGCAG -3'
(R):5'- AGTGGACCTAGGCTCAGTCAAC -3'
Posted On2014-10-01