Incidental Mutation 'R2134:Terf2ip'
ID233640
Institutional Source Beutler Lab
Gene Symbol Terf2ip
Ensembl Gene ENSMUSG00000033430
Gene Nametelomeric repeat binding factor 2, interacting protein
SynonymsRap1
MMRRC Submission 040137-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2134 (G1)
Quality Score171
Status Not validated
Chromosome8
Chromosomal Location112011398-112020528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112011639 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 53 (V53A)
Ref Sequence ENSEMBL: ENSMUSP00000052170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000052138] [ENSMUST00000071732] [ENSMUST00000093120] [ENSMUST00000164470] [ENSMUST00000211990]
Predicted Effect probably benign
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000052138
AA Change: V53A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052170
Gene: ENSMUSG00000033430
AA Change: V53A

DomainStartEndE-ValueType
Pfam:BRCT_2 17 100 1.4e-23 PFAM
Pfam:Myb_DNA-bind_2 129 193 3.9e-35 PFAM
low complexity region 279 298 N/A INTRINSIC
Pfam:Rap1_C 315 392 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071732
SMART Domains Protein: ENSMUSP00000128163
Gene: ENSMUSG00000092086

DomainStartEndE-ValueType
RRM 14 86 3.1e-26 SMART
RRM 105 177 8.1e-24 SMART
low complexity region 192 310 N/A INTRINSIC
low complexity region 321 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211978
Predicted Effect probably benign
Transcript: ENSMUST00000211990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212732
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that is part of a complex involved in telomere length regulation. Pseudogenes are present on chromosomes 5 and 22. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. Mice homozygous for a gene trapped allele die prior to E6.5 while heterozygous mice are resistant to LPS-induced mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Cenpf T C 1: 189,658,642 N998D probably benign Het
Ces2e T A 8: 104,932,539 probably null Het
Chd7 A G 4: 8,753,147 Q548R probably damaging Het
Chfr T A 5: 110,144,761 probably null Het
Clu A G 14: 65,974,841 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Ddx47 G T 6: 135,015,350 E113* probably null Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fastk T C 5: 24,445,141 R3G probably damaging Het
Fxr1 A T 3: 34,058,047 E367D probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vmn2r114 T A 17: 23,291,763 Y581F probably damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Terf2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Terf2ip APN 8 112012068 missense probably benign
R0244:Terf2ip UTSW 8 112018164 missense possibly damaging 0.73
R0544:Terf2ip UTSW 8 112015342 missense possibly damaging 0.88
R0617:Terf2ip UTSW 8 112011495 missense probably benign 0.10
R0976:Terf2ip UTSW 8 112011717 missense probably damaging 0.98
R1709:Terf2ip UTSW 8 112011606 frame shift probably null
R2078:Terf2ip UTSW 8 112015403 missense probably benign 0.02
R4572:Terf2ip UTSW 8 112012017 missense probably damaging 1.00
R6172:Terf2ip UTSW 8 112018017 missense probably damaging 1.00
R6266:Terf2ip UTSW 8 112011915 missense probably damaging 1.00
R6563:Terf2ip UTSW 8 112018202 missense probably damaging 1.00
R7180:Terf2ip UTSW 8 112011420 unclassified probably benign
R7203:Terf2ip UTSW 8 112017986 missense probably benign 0.30
R7222:Terf2ip UTSW 8 112011915 missense possibly damaging 0.64
R7304:Terf2ip UTSW 8 112011648 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTTACTTGTACAGCGGGGC -3'
(R):5'- CTCCTTCACGTAGGTCAGGATG -3'

Sequencing Primer
(F):5'- TTGTACAGCGGGGCGACAG -3'
(R):5'- ATGGCCACATCTTCCGCG -3'
Posted On2014-10-01