Mutagenetix > Incidental Mutations

Incidental Mutation 'R2134:Zzef1'

233650

Institutional Source

Beutler Lab

Gene Symbol

Zzef1

Ensembl Gene

ENSMUSG00000055670

Gene Name

zinc finger, ZZ-type with EF hand domain 1

Synonyms

C130099L13Rik, 8430405D05Rik

MMRRC Submission

040137-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2134 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72796226-72927120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72880624 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1644 (D1644G)

Ref Sequence

ENSEMBL: ENSMUSP00000147028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]

Predicted Effect

probably benign
Transcript: ENSMUST00000069395
AA Change: D1644G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: D1644G

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083364

Predicted Effect

probably benign
Transcript: ENSMUST00000172220
AA Change: D1644G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: D1644G

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207107
AA Change: D1644G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,030,917	V1437E	probably null	Het
Adam12	G	A	7: 134,012,288	R80*	probably null	Het
Adgrb3	G	T	1: 25,093,957	F479L	probably damaging	Het
Atf7ip	T	A	6: 136,605,487	V1165E	possibly damaging	Het
Atm	C	T	9: 53,467,964		probably null	Het
Atp11c	A	G	X: 60,276,783	Y593H	probably damaging	Het
Btnl1	A	G	17: 34,385,634	D463G	possibly damaging	Het
Cdc34b	T	G	11: 94,742,426	W151G	probably damaging	Het
Cdkal1	A	G	13: 29,354,677	S500P	possibly damaging	Het
Cenpf	T	C	1: 189,658,642	N998D	probably benign	Het
Ces2e	T	A	8: 104,932,539		probably null	Het
Chd7	A	G	4: 8,753,147	Q548R	probably damaging	Het
Chfr	T	A	5: 110,144,761		probably null	Het
Clu	A	G	14: 65,974,841		probably null	Het
Cntnap5c	A	G	17: 58,407,722	D1235G	probably damaging	Het
Col6a4	T	C	9: 106,066,661	S1205G	probably benign	Het
Ddx47	G	T	6: 135,015,350	E113*	probably null	Het
Dock4	A	G	12: 40,745,668	Y828C	probably benign	Het
Dync1h1	T	A	12: 110,656,631	N3553K	possibly damaging	Het
Egflam	C	T	15: 7,234,279	C730Y	probably damaging	Het
Fam83b	T	C	9: 76,491,016	Y935C	probably damaging	Het
Fam83g	A	G	11: 61,703,684	I681M	probably benign	Het
Fastk	T	C	5: 24,445,141	R3G	probably damaging	Het
Fxr1	A	T	3: 34,058,047	E367D	probably damaging	Het
Gatb	A	G	3: 85,611,370	D261G	probably damaging	Het
Gm5617	T	C	9: 48,495,817	S84P	possibly damaging	Het
Gm6614	T	C	6: 141,980,978	I541V	probably damaging	Het
Hecw1	C	T	13: 14,377,700	E104K	probably damaging	Het
Il31ra	T	C	13: 112,543,888	K265R	possibly damaging	Het
Khsrp	GTCATT	GT	17: 57,024,410		probably null	Het
Lrp2	T	A	2: 69,511,067	D923V	probably damaging	Het
Ltn1	A	G	16: 87,382,713	L1520P	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Map1s	T	G	8: 70,913,882	V477G	probably benign	Het
Mical1	T	C	10: 41,482,712	L542P	probably damaging	Het
Mycbp2	T	C	14: 103,208,893	Y1800C	probably damaging	Het
Mylk	A	T	16: 34,986,476	D1697V	probably benign	Het
Nlrp1a	A	T	11: 71,124,188	F79I	probably benign	Het
Olfr653	T	C	7: 104,579,641		probably benign	Het
Pde9a	A	G	17: 31,386,310	Y6C	probably damaging	Het
Plxnd1	A	T	6: 115,957,548	I1808N	probably damaging	Het
Ppp1r13b	T	A	12: 111,833,733	T537S	probably benign	Het
Ppp2r2a	A	G	14: 67,016,475	F415L	possibly damaging	Het
Rabgap1	C	T	2: 37,563,487	R976*	probably null	Het
Rbfox3	T	C	11: 118,497,016	H195R	probably damaging	Het
Ripk4	A	T	16: 97,743,733	D571E	probably damaging	Het
Sdhaf4	T	A	1: 24,005,553	R16S	probably benign	Het
Slc17a1	G	T	13: 23,875,675	G130*	probably null	Het
Slc6a1	G	T	6: 114,302,016	A23S	probably benign	Het
Soga3	T	A	10: 29,196,399	Y562*	probably null	Het
Spock1	T	A	13: 57,436,139	Q321L	probably damaging	Het
Syne2	A	G	12: 75,952,786	I2318V	probably damaging	Het
Terf2ip	T	C	8: 112,011,639	V53A	possibly damaging	Het
Thrb	T	C	14: 18,033,487	F403L	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Uqcrfs1	T	C	13: 30,540,804	K251R	probably benign	Het
Vmn2r111	T	C	17: 22,573,104	E57G	possibly damaging	Het
Vmn2r114	T	A	17: 23,291,763	Y581F	probably damaging	Het
Vps13d	A	G	4: 145,148,339	V1866A	probably benign	Het
Washc5	A	T	15: 59,369,234	F84Y	probably damaging	Het
Yars	T	A	4: 129,197,199	Y28*	probably null	Het
Zfp638	A	G	6: 83,928,982	Y43C	probably damaging	Het
Zfp750	T	A	11: 121,513,932	H39L	probably damaging	Het
Zfr2	C	A	10: 81,242,901	S322R	probably damaging	Het

Other mutations in Zzef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Zzef1	APN	11	72875126	missense	probably benign	0.02
IGL00898:Zzef1	APN	11	72875173	missense	probably benign	0.00
IGL00970:Zzef1	APN	11	72915245	missense	probably benign	0.06
IGL01062:Zzef1	APN	11	72874969	missense	probably benign
IGL01832:Zzef1	APN	11	72875066	missense	probably damaging	0.99
IGL02005:Zzef1	APN	11	72888299	missense	probably benign	0.00
IGL02026:Zzef1	APN	11	72881338	missense	probably benign	0.39
IGL02110:Zzef1	APN	11	72913112	missense	probably damaging	1.00
IGL02305:Zzef1	APN	11	72866597	splice site	probably benign
IGL02308:Zzef1	APN	11	72886747	missense	probably benign	0.04
IGL02315:Zzef1	APN	11	72875257	nonsense	probably null
IGL02332:Zzef1	APN	11	72916509	missense	probably benign	0.01
IGL02389:Zzef1	APN	11	72891217	missense	probably benign
IGL02389:Zzef1	APN	11	72899538	missense	possibly damaging	0.89
IGL02451:Zzef1	APN	11	72901388	missense	probably damaging	0.99
IGL02541:Zzef1	APN	11	72872649	missense	probably damaging	1.00
IGL02950:Zzef1	APN	11	72917699	splice site	probably benign
IGL02953:Zzef1	APN	11	72855398	missense	probably benign
IGL03053:Zzef1	APN	11	72831539	splice site	probably benign
IGL03085:Zzef1	APN	11	72855524	splice site	probably benign
IGL03152:Zzef1	APN	11	72923182	critical splice donor site	probably null
IGL03329:Zzef1	APN	11	72917273	splice site	probably benign
IGL03376:Zzef1	APN	11	72876551	splice site	probably benign
IGL03394:Zzef1	APN	11	72886775	splice site	probably null
Dreidel	UTSW	11	72908469	nonsense	probably null
Hanukkah	UTSW	11	72893332	missense	probably benign	0.00
Mezuzah	UTSW	11	72848733	nonsense	probably null
BB005:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
BB015:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
PIT4508001:Zzef1	UTSW	11	72895176	missense	probably benign
PIT4581001:Zzef1	UTSW	11	72899672	missense	probably benign	0.00
PIT4810001:Zzef1	UTSW	11	72850745	missense	probably damaging	1.00
R0094:Zzef1	UTSW	11	72817965	missense	probably benign	0.01
R0119:Zzef1	UTSW	11	72821851	missense	probably benign
R0136:Zzef1	UTSW	11	72821851	missense	probably benign
R0140:Zzef1	UTSW	11	72899551	missense	possibly damaging	0.70
R0212:Zzef1	UTSW	11	72873910	missense	possibly damaging	0.66
R0217:Zzef1	UTSW	11	72889068	missense	probably damaging	1.00
R0220:Zzef1	UTSW	11	72865966	missense	probably damaging	1.00
R0304:Zzef1	UTSW	11	72880624	missense	probably benign	0.10
R0400:Zzef1	UTSW	11	72895242	missense	probably damaging	1.00
R0422:Zzef1	UTSW	11	72866091	missense	possibly damaging	0.93
R0471:Zzef1	UTSW	11	72923111	missense	probably damaging	1.00
R0557:Zzef1	UTSW	11	72917730	missense	probably damaging	1.00
R0581:Zzef1	UTSW	11	72851900	missense	probably benign	0.00
R0599:Zzef1	UTSW	11	72913178	missense	probably damaging	1.00
R0603:Zzef1	UTSW	11	72818069	missense	probably benign	0.00
R0657:Zzef1	UTSW	11	72821851	missense	probably benign
R0987:Zzef1	UTSW	11	72901333	small deletion	probably benign
R1246:Zzef1	UTSW	11	72874909	missense	probably benign	0.00
R1327:Zzef1	UTSW	11	72893414	critical splice donor site	probably null
R1438:Zzef1	UTSW	11	72912945	missense	probably damaging	0.96
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1485:Zzef1	UTSW	11	72900809	splice site	probably null
R1556:Zzef1	UTSW	11	72915233	missense	probably damaging	1.00
R1563:Zzef1	UTSW	11	72848733	nonsense	probably null
R1584:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1643:Zzef1	UTSW	11	72826202	missense	probably damaging	1.00
R1646:Zzef1	UTSW	11	72864036	critical splice donor site	probably null
R1764:Zzef1	UTSW	11	72893332	missense	probably benign	0.00
R1777:Zzef1	UTSW	11	72910272	missense	probably damaging	1.00
R1793:Zzef1	UTSW	11	72886709	missense	probably damaging	1.00
R1900:Zzef1	UTSW	11	72848714	missense	probably damaging	0.99
R2096:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R2157:Zzef1	UTSW	11	72848634	splice site	probably benign
R2183:Zzef1	UTSW	11	72886718	nonsense	probably null
R2192:Zzef1	UTSW	11	72910156	splice site	probably null
R2230:Zzef1	UTSW	11	72884416	missense	probably damaging	0.99
R2259:Zzef1	UTSW	11	72900633	nonsense	probably null
R2384:Zzef1	UTSW	11	72858394	missense	probably damaging	0.99
R2426:Zzef1	UTSW	11	72915265	missense	probably benign	0.01
R2915:Zzef1	UTSW	11	72910326	splice site	probably null
R3700:Zzef1	UTSW	11	72886772	missense	probably null	1.00
R3875:Zzef1	UTSW	11	72889040	missense	probably benign	0.22
R3902:Zzef1	UTSW	11	72908500	missense	probably damaging	1.00
R3927:Zzef1	UTSW	11	72858382	missense	probably damaging	1.00
R4086:Zzef1	UTSW	11	72875053	missense	probably benign	0.02
R4301:Zzef1	UTSW	11	72889035	missense	probably damaging	0.96
R4359:Zzef1	UTSW	11	72823508	missense	probably damaging	0.98
R4382:Zzef1	UTSW	11	72875112	missense	probably benign	0.00
R4453:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R4466:Zzef1	UTSW	11	72924659	missense	probably damaging	1.00
R4471:Zzef1	UTSW	11	72913331	missense	probably damaging	1.00
R4510:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4511:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4714:Zzef1	UTSW	11	72837212	missense	probably damaging	1.00
R4799:Zzef1	UTSW	11	72859623	missense	probably benign	0.12
R4906:Zzef1	UTSW	11	72901388	missense	probably damaging	1.00
R5075:Zzef1	UTSW	11	72858344	missense	probably damaging	1.00
R5357:Zzef1	UTSW	11	72843333	nonsense	probably null
R5579:Zzef1	UTSW	11	72900637	missense	probably damaging	0.98
R5598:Zzef1	UTSW	11	72916521	missense	probably damaging	1.00
R5725:Zzef1	UTSW	11	72855482	missense	possibly damaging	0.86
R5765:Zzef1	UTSW	11	72821937	nonsense	probably null
R5928:Zzef1	UTSW	11	72912852	missense	probably damaging	1.00
R6003:Zzef1	UTSW	11	72824065	splice site	probably null
R6047:Zzef1	UTSW	11	72866095	missense	probably damaging	0.99
R6224:Zzef1	UTSW	11	72855383	missense	probably damaging	0.99
R6225:Zzef1	UTSW	11	72869805	missense	possibly damaging	0.62
R6287:Zzef1	UTSW	11	72923112	missense	probably damaging	1.00
R6361:Zzef1	UTSW	11	72884349	missense	possibly damaging	0.93
R6451:Zzef1	UTSW	11	72923156	missense	possibly damaging	0.88
R6467:Zzef1	UTSW	11	72911264	critical splice donor site	probably null
R6484:Zzef1	UTSW	11	72895271	missense	probably damaging	1.00
R6493:Zzef1	UTSW	11	72913303	missense	probably benign	0.06
R6520:Zzef1	UTSW	11	72826065	missense	probably damaging	1.00
R6527:Zzef1	UTSW	11	72874990	missense	probably benign	0.00
R6540:Zzef1	UTSW	11	72913229	missense	probably damaging	1.00
R6608:Zzef1	UTSW	11	72912826	missense	probably damaging	1.00
R6795:Zzef1	UTSW	11	72850659	missense	probably benign	0.00
R6927:Zzef1	UTSW	11	72913157	missense	probably damaging	1.00
R6987:Zzef1	UTSW	11	72855514	missense	possibly damaging	0.89
R7048:Zzef1	UTSW	11	72866699	nonsense	probably null
R7076:Zzef1	UTSW	11	72899559	missense	probably benign	0.00
R7099:Zzef1	UTSW	11	72872649	missense	possibly damaging	0.92
R7132:Zzef1	UTSW	11	72917871	critical splice donor site	probably null
R7175:Zzef1	UTSW	11	72851901	missense	possibly damaging	0.49
R7284:Zzef1	UTSW	11	72886690	missense	probably damaging	0.99
R7300:Zzef1	UTSW	11	72875004	missense	probably benign	0.02
R7486:Zzef1	UTSW	11	72864786	missense	possibly damaging	0.85
R7503:Zzef1	UTSW	11	72826067	missense	probably damaging	1.00
R7679:Zzef1	UTSW	11	72893278	missense	probably benign
R7874:Zzef1	UTSW	11	72859653	missense	probably benign	0.01
R7898:Zzef1	UTSW	11	72796547	missense	probably damaging	1.00
R7928:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
R8021:Zzef1	UTSW	11	72823416	missense	probably damaging	0.99
R8145:Zzef1	UTSW	11	72908469	nonsense	probably null
R8255:Zzef1	UTSW	11	72875129	missense	probably benign	0.00
R8303:Zzef1	UTSW	11	72917189	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72872604	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72886746	missense	probably damaging	0.97
R8498:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R8547:Zzef1	UTSW	11	72844441	missense	probably damaging	1.00
X0028:Zzef1	UTSW	11	72906979	missense	probably benign	0.29
Z1176:Zzef1	UTSW	11	72796528	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72796312	missense	possibly damaging	0.91
Z1177:Zzef1	UTSW	11	72826178	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72900631	critical splice acceptor site	probably null
Z1177:Zzef1	UTSW	11	72915320	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCCAACTGGACTTGAATGTCAC -3'
(R):5'- TCAGACACTGAAGATAACAGGC -3'

Sequencing Primer
(F):5'- AACTGGACTTGAATGTCACTGTCC -3'
(R):5'- AGGTAATCCAGTACCTGTC -3'

Posted On

2014-10-01