Mutagenetix > Incidental Mutations

Incidental Mutation 'R2134:Zzef1'

233650

Institutional Source

Beutler Lab

Gene Symbol

Zzef1

Ensembl Gene

ENSMUSG00000055670

Gene Name

zinc finger, ZZ-type with EF hand domain 1

Synonyms

C130099L13Rik, 8430405D05Rik

MMRRC Submission

040137-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2134 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72796226-72927120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72880624 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1644 (D1644G)

Ref Sequence

ENSEMBL: ENSMUSP00000147028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]

Predicted Effect

probably benign
Transcript: ENSMUST00000069395
AA Change: D1644G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: D1644G

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083364

Predicted Effect

probably benign
Transcript: ENSMUST00000172220
AA Change: D1644G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: D1644G

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207107
AA Change: D1644G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,030,917	V1437E	probably null	Het
Adam12	G	A	7: 134,012,288	R80*	probably null	Het
Adgrb3	G	T	1: 25,093,957	F479L	probably damaging	Het
Atf7ip	T	A	6: 136,605,487	V1165E	possibly damaging	Het
Atm	C	T	9: 53,467,964		probably null	Het
Atp11c	A	G	X: 60,276,783	Y593H	probably damaging	Het
Btnl1	A	G	17: 34,385,634	D463G	possibly damaging	Het
Cdc34b	T	G	11: 94,742,426	W151G	probably damaging	Het
Cdkal1	A	G	13: 29,354,677	S500P	possibly damaging	Het
Cenpf	T	C	1: 189,658,642	N998D	probably benign	Het
Ces2e	T	A	8: 104,932,539		probably null	Het
Chd7	A	G	4: 8,753,147	Q548R	probably damaging	Het
Chfr	T	A	5: 110,144,761		probably null	Het
Clu	A	G	14: 65,974,841		probably null	Het
Cntnap5c	A	G	17: 58,407,722	D1235G	probably damaging	Het
Col6a4	T	C	9: 106,066,661	S1205G	probably benign	Het
Ddx47	G	T	6: 135,015,350	E113*	probably null	Het
Dock4	A	G	12: 40,745,668	Y828C	probably benign	Het
Dync1h1	T	A	12: 110,656,631	N3553K	possibly damaging	Het
Egflam	C	T	15: 7,234,279	C730Y	probably damaging	Het
Fam83b	T	C	9: 76,491,016	Y935C	probably damaging	Het
Fam83g	A	G	11: 61,703,684	I681M	probably benign	Het
Fastk	T	C	5: 24,445,141	R3G	probably damaging	Het
Fxr1	A	T	3: 34,058,047	E367D	probably damaging	Het
Gatb	A	G	3: 85,611,370	D261G	probably damaging	Het
Gm5617	T	C	9: 48,495,817	S84P	possibly damaging	Het
Gm6614	T	C	6: 141,980,978	I541V	probably damaging	Het
Hecw1	C	T	13: 14,377,700	E104K	probably damaging	Het
Il31ra	T	C	13: 112,543,888	K265R	possibly damaging	Het
Khsrp	GTCATT	GT	17: 57,024,410		probably null	Het
Lrp2	T	A	2: 69,511,067	D923V	probably damaging	Het
Ltn1	A	G	16: 87,382,713	L1520P	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Map1s	T	G	8: 70,913,882	V477G	probably benign	Het
Mical1	T	C	10: 41,482,712	L542P	probably damaging	Het
Mycbp2	T	C	14: 103,208,893	Y1800C	probably damaging	Het
Mylk	A	T	16: 34,986,476	D1697V	probably benign	Het
Nlrp1a	A	T	11: 71,124,188	F79I	probably benign	Het
Olfr653	T	C	7: 104,579,641		probably benign	Het
Pde9a	A	G	17: 31,386,310	Y6C	probably damaging	Het
Plxnd1	A	T	6: 115,957,548	I1808N	probably damaging	Het
Ppp1r13b	T	A	12: 111,833,733	T537S	probably benign	Het
Ppp2r2a	A	G	14: 67,016,475	F415L	possibly damaging	Het
Rabgap1	C	T	2: 37,563,487	R976*	probably null	Het
Rbfox3	T	C	11: 118,497,016	H195R	probably damaging	Het
Ripk4	A	T	16: 97,743,733	D571E	probably damaging	Het
Sdhaf4	T	A	1: 24,005,553	R16S	probably benign	Het
Slc17a1	G	T	13: 23,875,675	G130*	probably null	Het
Slc6a1	G	T	6: 114,302,016	A23S	probably benign	Het
Soga3	T	A	10: 29,196,399	Y562*	probably null	Het
Spock1	T	A	13: 57,436,139	Q321L	probably damaging	Het
Syne2	A	G	12: 75,952,786	I2318V	probably damaging	Het
Terf2ip	T	C	8: 112,011,639	V53A	possibly damaging	Het
Thrb	T	C	14: 18,033,487	F403L	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Uqcrfs1	T	C	13: 30,540,804	K251R	probably benign	Het
Vmn2r111	T	C	17: 22,573,104	E57G	possibly damaging	Het
Vmn2r114	T	A	17: 23,291,763	Y581F	probably damaging	Het
Vps13d	A	G	4: 145,148,339	V1866A	probably benign	Het
Washc5	A	T	15: 59,369,234	F84Y	probably damaging	Het
Yars	T	A	4: 129,197,199	Y28*	probably null	Het
Zfp638	A	G	6: 83,928,982	Y43C	probably damaging	Het
Zfp750	T	A	11: 121,513,932	H39L	probably damaging	Het
Zfr2	C	A	10: 81,242,901	S322R	probably damaging	Het

Other mutations in Zzef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Zzef1	APN	11	72875126	missense	probably benign	0.02
IGL00898:Zzef1	APN	11	72875173	missense	probably benign	0.00
IGL00970:Zzef1	APN	11	72915245	missense	probably benign	0.06
IGL01062:Zzef1	APN	11	72874969	missense	probably benign
IGL01832:Zzef1	APN	11	72875066	missense	probably damaging	0.99
IGL02005:Zzef1	APN	11	72888299	missense	probably benign	0.00
IGL02026:Zzef1	APN	11	72881338	missense	probably benign	0.39
IGL02110:Zzef1	APN	11	72913112	missense	probably damaging	1.00
IGL02305:Zzef1	APN	11	72866597	splice site	probably benign
IGL02308:Zzef1	APN	11	72886747	missense	probably benign	0.04
IGL02315:Zzef1	APN	11	72875257	nonsense	probably null
IGL02332:Zzef1	APN	11	72916509	missense	probably benign	0.01
IGL02389:Zzef1	APN	11	72891217	missense	probably benign
IGL02389:Zzef1	APN	11	72899538	missense	possibly damaging	0.89
IGL02451:Zzef1	APN	11	72901388	missense	probably damaging	0.99
IGL02541:Zzef1	APN	11	72872649	missense	probably damaging	1.00
IGL02950:Zzef1	APN	11	72917699	splice site	probably benign
IGL02953:Zzef1	APN	11	72855398	missense	probably benign
IGL03053:Zzef1	APN	11	72831539	splice site	probably benign
IGL03085:Zzef1	APN	11	72855524	splice site	probably benign
IGL03152:Zzef1	APN	11	72923182	critical splice donor site	probably null
IGL03329:Zzef1	APN	11	72917273	splice site	probably benign
IGL03376:Zzef1	APN	11	72876551	splice site	probably benign
IGL03394:Zzef1	APN	11	72886775	splice site	probably null
PIT4508001:Zzef1	UTSW	11	72895176	missense	probably benign
PIT4581001:Zzef1	UTSW	11	72899672	missense	probably benign	0.00
PIT4810001:Zzef1	UTSW	11	72850745	missense	probably damaging	1.00
R0094:Zzef1	UTSW	11	72817965	missense	probably benign	0.01
R0119:Zzef1	UTSW	11	72821851	missense	probably benign
R0136:Zzef1	UTSW	11	72821851	missense	probably benign
R0140:Zzef1	UTSW	11	72899551	missense	possibly damaging	0.70
R0212:Zzef1	UTSW	11	72873910	missense	possibly damaging	0.66
R0217:Zzef1	UTSW	11	72889068	missense	probably damaging	1.00
R0220:Zzef1	UTSW	11	72865966	missense	probably damaging	1.00
R0304:Zzef1	UTSW	11	72880624	missense	probably benign	0.10
R0400:Zzef1	UTSW	11	72895242	missense	probably damaging	1.00
R0422:Zzef1	UTSW	11	72866091	missense	possibly damaging	0.93
R0471:Zzef1	UTSW	11	72923111	missense	probably damaging	1.00
R0557:Zzef1	UTSW	11	72917730	missense	probably damaging	1.00
R0581:Zzef1	UTSW	11	72851900	missense	probably benign	0.00
R0599:Zzef1	UTSW	11	72913178	missense	probably damaging	1.00
R0603:Zzef1	UTSW	11	72818069	missense	probably benign	0.00
R0657:Zzef1	UTSW	11	72821851	missense	probably benign
R0987:Zzef1	UTSW	11	72901333	small deletion	probably benign
R1246:Zzef1	UTSW	11	72874909	missense	probably benign	0.00
R1327:Zzef1	UTSW	11	72893414	critical splice donor site	probably null
R1438:Zzef1	UTSW	11	72912945	missense	probably damaging	0.96
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1485:Zzef1	UTSW	11	72900809	splice site	probably null
R1556:Zzef1	UTSW	11	72915233	missense	probably damaging	1.00
R1563:Zzef1	UTSW	11	72848733	nonsense	probably null
R1584:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1643:Zzef1	UTSW	11	72826202	missense	probably damaging	1.00
R1646:Zzef1	UTSW	11	72864036	critical splice donor site	probably null
R1764:Zzef1	UTSW	11	72893332	missense	probably benign	0.00
R1777:Zzef1	UTSW	11	72910272	missense	probably damaging	1.00
R1793:Zzef1	UTSW	11	72886709	missense	probably damaging	1.00
R1900:Zzef1	UTSW	11	72848714	missense	probably damaging	0.99
R2096:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R2157:Zzef1	UTSW	11	72848634	splice site	probably benign
R2183:Zzef1	UTSW	11	72886718	nonsense	probably null
R2192:Zzef1	UTSW	11	72910156	synonymous	probably null
R2230:Zzef1	UTSW	11	72884416	missense	probably damaging	0.99
R2259:Zzef1	UTSW	11	72900633	nonsense	probably null
R2384:Zzef1	UTSW	11	72858394	missense	probably damaging	0.99
R2426:Zzef1	UTSW	11	72915265	missense	probably benign	0.01
R2915:Zzef1	UTSW	11	72910326	splice site	probably null
R3700:Zzef1	UTSW	11	72886772	missense	probably null	1.00
R3875:Zzef1	UTSW	11	72889040	missense	probably benign	0.22
R3902:Zzef1	UTSW	11	72908500	missense	probably damaging	1.00
R3927:Zzef1	UTSW	11	72858382	missense	probably damaging	1.00
R4086:Zzef1	UTSW	11	72875053	missense	probably benign	0.02
R4301:Zzef1	UTSW	11	72889035	missense	probably damaging	0.96
R4359:Zzef1	UTSW	11	72823508	missense	probably damaging	0.98
R4382:Zzef1	UTSW	11	72875112	missense	probably benign	0.00
R4453:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R4466:Zzef1	UTSW	11	72924659	missense	probably damaging	1.00
R4471:Zzef1	UTSW	11	72913331	missense	probably damaging	1.00
R4510:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4511:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4714:Zzef1	UTSW	11	72837212	missense	probably damaging	1.00
R4799:Zzef1	UTSW	11	72859623	missense	probably benign	0.12
R4906:Zzef1	UTSW	11	72901388	missense	probably damaging	1.00
R5075:Zzef1	UTSW	11	72858344	missense	probably damaging	1.00
R5357:Zzef1	UTSW	11	72843333	nonsense	probably null
R5579:Zzef1	UTSW	11	72900637	missense	probably damaging	0.98
R5598:Zzef1	UTSW	11	72916521	missense	probably damaging	1.00
R5725:Zzef1	UTSW	11	72855482	missense	possibly damaging	0.86
R5765:Zzef1	UTSW	11	72821937	nonsense	probably null
R5928:Zzef1	UTSW	11	72912852	missense	probably damaging	1.00
R6003:Zzef1	UTSW	11	72824065	splice site	probably null
R6047:Zzef1	UTSW	11	72866095	missense	probably damaging	0.99
R6224:Zzef1	UTSW	11	72855383	missense	probably damaging	0.99
R6225:Zzef1	UTSW	11	72869805	missense	possibly damaging	0.62
R6287:Zzef1	UTSW	11	72923112	missense	probably damaging	1.00
R6361:Zzef1	UTSW	11	72884349	missense	possibly damaging	0.93
R6451:Zzef1	UTSW	11	72923156	missense	possibly damaging	0.88
R6467:Zzef1	UTSW	11	72911264	critical splice donor site	probably null
R6484:Zzef1	UTSW	11	72895271	missense	probably damaging	1.00
R6493:Zzef1	UTSW	11	72913303	missense	probably benign	0.06
R6520:Zzef1	UTSW	11	72826065	missense	probably damaging	1.00
R6527:Zzef1	UTSW	11	72874990	missense	probably benign	0.00
R6540:Zzef1	UTSW	11	72913229	missense	probably damaging	1.00
R6608:Zzef1	UTSW	11	72912826	missense	probably damaging	1.00
R6795:Zzef1	UTSW	11	72850659	missense	probably benign	0.00
R6927:Zzef1	UTSW	11	72913157	missense	probably damaging	1.00
R6987:Zzef1	UTSW	11	72855514	missense	possibly damaging	0.89
R7048:Zzef1	UTSW	11	72866699	nonsense	probably null
R7076:Zzef1	UTSW	11	72899559	missense	probably benign	0.00
R7099:Zzef1	UTSW	11	72872649	missense	possibly damaging	0.92
R7132:Zzef1	UTSW	11	72917871	critical splice donor site	probably null
R7175:Zzef1	UTSW	11	72851901	missense	possibly damaging	0.49
R7284:Zzef1	UTSW	11	72886690	missense	probably damaging	0.99
R7300:Zzef1	UTSW	11	72875004	missense	probably benign	0.02
R7486:Zzef1	UTSW	11	72864786	missense	possibly damaging	0.85
R7503:Zzef1	UTSW	11	72826067	missense	probably damaging	1.00
R7679:Zzef1	UTSW	11	72893278	missense	probably benign
R7874:Zzef1	UTSW	11	72859653	missense	probably benign	0.01
R7898:Zzef1	UTSW	11	72796547	missense	probably damaging	1.00
R7957:Zzef1	UTSW	11	72859653	missense	probably benign	0.01
R7981:Zzef1	UTSW	11	72796547	missense	probably damaging	1.00
X0028:Zzef1	UTSW	11	72906979	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- AACCCAACTGGACTTGAATGTCAC -3'
(R):5'- TCAGACACTGAAGATAACAGGC -3'

Sequencing Primer
(F):5'- AACTGGACTTGAATGTCACTGTCC -3'
(R):5'- AGGTAATCCAGTACCTGTC -3'

Posted On

2014-10-01