Mutagenetix > Incidental Mutations

Incidental Mutation 'R2134:Ltn1'

233672

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

040137-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2134 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87382713 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1520 (L1520P)

Ref Sequence

ENSEMBL: ENSMUSP00000038775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039449
AA Change: L1520P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: L1520P

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Meta Mutation Damage Score

0.9181

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,030,917	V1437E	probably null	Het
Adam12	G	A	7: 134,012,288	R80*	probably null	Het
Adgrb3	G	T	1: 25,093,957	F479L	probably damaging	Het
Atf7ip	T	A	6: 136,605,487	V1165E	possibly damaging	Het
Atm	C	T	9: 53,467,964		probably null	Het
Atp11c	A	G	X: 60,276,783	Y593H	probably damaging	Het
Btnl1	A	G	17: 34,385,634	D463G	possibly damaging	Het
Cdc34b	T	G	11: 94,742,426	W151G	probably damaging	Het
Cdkal1	A	G	13: 29,354,677	S500P	possibly damaging	Het
Cenpf	T	C	1: 189,658,642	N998D	probably benign	Het
Ces2e	T	A	8: 104,932,539		probably null	Het
Chd7	A	G	4: 8,753,147	Q548R	probably damaging	Het
Chfr	T	A	5: 110,144,761		probably null	Het
Clu	A	G	14: 65,974,841		probably null	Het
Cntnap5c	A	G	17: 58,407,722	D1235G	probably damaging	Het
Col6a4	T	C	9: 106,066,661	S1205G	probably benign	Het
Ddx47	G	T	6: 135,015,350	E113*	probably null	Het
Dock4	A	G	12: 40,745,668	Y828C	probably benign	Het
Dync1h1	T	A	12: 110,656,631	N3553K	possibly damaging	Het
Egflam	C	T	15: 7,234,279	C730Y	probably damaging	Het
Fam83b	T	C	9: 76,491,016	Y935C	probably damaging	Het
Fam83g	A	G	11: 61,703,684	I681M	probably benign	Het
Fastk	T	C	5: 24,445,141	R3G	probably damaging	Het
Fxr1	A	T	3: 34,058,047	E367D	probably damaging	Het
Gatb	A	G	3: 85,611,370	D261G	probably damaging	Het
Gm5617	T	C	9: 48,495,817	S84P	possibly damaging	Het
Gm6614	T	C	6: 141,980,978	I541V	probably damaging	Het
Hecw1	C	T	13: 14,377,700	E104K	probably damaging	Het
Il31ra	T	C	13: 112,543,888	K265R	possibly damaging	Het
Khsrp	GTCATT	GT	17: 57,024,410		probably null	Het
Lrp2	T	A	2: 69,511,067	D923V	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Map1s	T	G	8: 70,913,882	V477G	probably benign	Het
Mical1	T	C	10: 41,482,712	L542P	probably damaging	Het
Mycbp2	T	C	14: 103,208,893	Y1800C	probably damaging	Het
Mylk	A	T	16: 34,986,476	D1697V	probably benign	Het
Nlrp1a	A	T	11: 71,124,188	F79I	probably benign	Het
Olfr653	T	C	7: 104,579,641		probably benign	Het
Pde9a	A	G	17: 31,386,310	Y6C	probably damaging	Het
Plxnd1	A	T	6: 115,957,548	I1808N	probably damaging	Het
Ppp1r13b	T	A	12: 111,833,733	T537S	probably benign	Het
Ppp2r2a	A	G	14: 67,016,475	F415L	possibly damaging	Het
Rabgap1	C	T	2: 37,563,487	R976*	probably null	Het
Rbfox3	T	C	11: 118,497,016	H195R	probably damaging	Het
Ripk4	A	T	16: 97,743,733	D571E	probably damaging	Het
Sdhaf4	T	A	1: 24,005,553	R16S	probably benign	Het
Slc17a1	G	T	13: 23,875,675	G130*	probably null	Het
Slc6a1	G	T	6: 114,302,016	A23S	probably benign	Het
Soga3	T	A	10: 29,196,399	Y562*	probably null	Het
Spock1	T	A	13: 57,436,139	Q321L	probably damaging	Het
Syne2	A	G	12: 75,952,786	I2318V	probably damaging	Het
Terf2ip	T	C	8: 112,011,639	V53A	possibly damaging	Het
Thrb	T	C	14: 18,033,487	F403L	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Uqcrfs1	T	C	13: 30,540,804	K251R	probably benign	Het
Vmn2r111	T	C	17: 22,573,104	E57G	possibly damaging	Het
Vmn2r114	T	A	17: 23,291,763	Y581F	probably damaging	Het
Vps13d	A	G	4: 145,148,339	V1866A	probably benign	Het
Washc5	A	T	15: 59,369,234	F84Y	probably damaging	Het
Yars	T	A	4: 129,197,199	Y28*	probably null	Het
Zfp638	A	G	6: 83,928,982	Y43C	probably damaging	Het
Zfp750	T	A	11: 121,513,932	H39L	probably damaging	Het
Zfr2	C	A	10: 81,242,901	S322R	probably damaging	Het
Zzef1	A	G	11: 72,880,624	D1644G	probably benign	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAGACGTTACGCACATGTAGCC -3'
(R):5'- GTGTTCTGCCACTGACCTAC -3'

Sequencing Primer
(F):5'- CATGTAGCCCACAGACGTGTAG -3'
(R):5'- CCACGTGTGGGGATACATTCTAC -3'

Posted On

2014-10-01