Mutagenetix > Incidental Mutations

Incidental Mutation 'R2134:Vmn2r111'

233674

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

040137-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R2134 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22573104 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 57 (E57G)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: E57G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: E57G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,030,917	V1437E	probably null	Het
Adam12	G	A	7: 134,012,288	R80*	probably null	Het
Adgrb3	G	T	1: 25,093,957	F479L	probably damaging	Het
Atf7ip	T	A	6: 136,605,487	V1165E	possibly damaging	Het
Atm	C	T	9: 53,467,964		probably null	Het
Atp11c	A	G	X: 60,276,783	Y593H	probably damaging	Het
Btnl1	A	G	17: 34,385,634	D463G	possibly damaging	Het
Cdc34b	T	G	11: 94,742,426	W151G	probably damaging	Het
Cdkal1	A	G	13: 29,354,677	S500P	possibly damaging	Het
Cenpf	T	C	1: 189,658,642	N998D	probably benign	Het
Ces2e	T	A	8: 104,932,539		probably null	Het
Chd7	A	G	4: 8,753,147	Q548R	probably damaging	Het
Chfr	T	A	5: 110,144,761		probably null	Het
Clu	A	G	14: 65,974,841		probably null	Het
Cntnap5c	A	G	17: 58,407,722	D1235G	probably damaging	Het
Col6a4	T	C	9: 106,066,661	S1205G	probably benign	Het
Ddx47	G	T	6: 135,015,350	E113*	probably null	Het
Dock4	A	G	12: 40,745,668	Y828C	probably benign	Het
Dync1h1	T	A	12: 110,656,631	N3553K	possibly damaging	Het
Egflam	C	T	15: 7,234,279	C730Y	probably damaging	Het
Fam83b	T	C	9: 76,491,016	Y935C	probably damaging	Het
Fam83g	A	G	11: 61,703,684	I681M	probably benign	Het
Fastk	T	C	5: 24,445,141	R3G	probably damaging	Het
Fxr1	A	T	3: 34,058,047	E367D	probably damaging	Het
Gatb	A	G	3: 85,611,370	D261G	probably damaging	Het
Gm5617	T	C	9: 48,495,817	S84P	possibly damaging	Het
Gm6614	T	C	6: 141,980,978	I541V	probably damaging	Het
Hecw1	C	T	13: 14,377,700	E104K	probably damaging	Het
Il31ra	T	C	13: 112,543,888	K265R	possibly damaging	Het
Khsrp	GTCATT	GT	17: 57,024,410		probably null	Het
Lrp2	T	A	2: 69,511,067	D923V	probably damaging	Het
Ltn1	A	G	16: 87,382,713	L1520P	probably damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Map1s	T	G	8: 70,913,882	V477G	probably benign	Het
Mical1	T	C	10: 41,482,712	L542P	probably damaging	Het
Mycbp2	T	C	14: 103,208,893	Y1800C	probably damaging	Het
Mylk	A	T	16: 34,986,476	D1697V	probably benign	Het
Nlrp1a	A	T	11: 71,124,188	F79I	probably benign	Het
Olfr653	T	C	7: 104,579,641		probably benign	Het
Pde9a	A	G	17: 31,386,310	Y6C	probably damaging	Het
Plxnd1	A	T	6: 115,957,548	I1808N	probably damaging	Het
Ppp1r13b	T	A	12: 111,833,733	T537S	probably benign	Het
Ppp2r2a	A	G	14: 67,016,475	F415L	possibly damaging	Het
Rabgap1	C	T	2: 37,563,487	R976*	probably null	Het
Rbfox3	T	C	11: 118,497,016	H195R	probably damaging	Het
Ripk4	A	T	16: 97,743,733	D571E	probably damaging	Het
Sdhaf4	T	A	1: 24,005,553	R16S	probably benign	Het
Slc17a1	G	T	13: 23,875,675	G130*	probably null	Het
Slc6a1	G	T	6: 114,302,016	A23S	probably benign	Het
Soga3	T	A	10: 29,196,399	Y562*	probably null	Het
Spock1	T	A	13: 57,436,139	Q321L	probably damaging	Het
Syne2	A	G	12: 75,952,786	I2318V	probably damaging	Het
Terf2ip	T	C	8: 112,011,639	V53A	possibly damaging	Het
Thrb	T	C	14: 18,033,487	F403L	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Uqcrfs1	T	C	13: 30,540,804	K251R	probably benign	Het
Vmn2r114	T	A	17: 23,291,763	Y581F	probably damaging	Het
Vps13d	A	G	4: 145,148,339	V1866A	probably benign	Het
Washc5	A	T	15: 59,369,234	F84Y	probably damaging	Het
Yars	T	A	4: 129,197,199	Y28*	probably null	Het
Zfp638	A	G	6: 83,928,982	Y43C	probably damaging	Het
Zfp750	T	A	11: 121,513,932	H39L	probably damaging	Het
Zfr2	C	A	10: 81,242,901	S322R	probably damaging	Het
Zzef1	A	G	11: 72,880,624	D1644G	probably benign	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGTGAAATGGAAACTGTCTAGG -3'
(R):5'- ATACTGCCCAGGCTCAGAAC -3'

Sequencing Primer
(F):5'- GCTAAGTTTCCATCCTTGTTAATGAG -3'
(R):5'- CCCAGGCTCAGAACAGGAAAAATATG -3'

Posted On

2014-10-01