Incidental Mutation 'R2134:Vmn2r111'
ID 233674
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 040137-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2134 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22792085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 57 (E57G)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: E57G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: E57G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 109,921,743 (GRCm39) V1437E probably null Het
Adam12 G A 7: 133,614,017 (GRCm39) R80* probably null Het
Adgrb3 G T 1: 25,133,038 (GRCm39) F479L probably damaging Het
Atf7ip T A 6: 136,582,485 (GRCm39) V1165E possibly damaging Het
Atm C T 9: 53,379,264 (GRCm39) probably null Het
Atp11c A G X: 59,322,143 (GRCm39) Y593H probably damaging Het
Btnl1 A G 17: 34,604,608 (GRCm39) D463G possibly damaging Het
Cdc34b T G 11: 94,633,252 (GRCm39) W151G probably damaging Het
Cdkal1 A G 13: 29,538,660 (GRCm39) S500P possibly damaging Het
Cenpf T C 1: 189,390,839 (GRCm39) N998D probably benign Het
Ces2e T A 8: 105,659,171 (GRCm39) probably null Het
Chd7 A G 4: 8,753,147 (GRCm39) Q548R probably damaging Het
Chfr T A 5: 110,292,627 (GRCm39) probably null Het
Clu A G 14: 66,212,290 (GRCm39) probably null Het
Cntnap5c A G 17: 58,714,717 (GRCm39) D1235G probably damaging Het
Col6a4 T C 9: 105,943,860 (GRCm39) S1205G probably benign Het
Ddx47 G T 6: 134,992,313 (GRCm39) E113* probably null Het
Dock4 A G 12: 40,795,667 (GRCm39) Y828C probably benign Het
Dync1h1 T A 12: 110,623,065 (GRCm39) N3553K possibly damaging Het
Egflam C T 15: 7,263,760 (GRCm39) C730Y probably damaging Het
Fam83b T C 9: 76,398,298 (GRCm39) Y935C probably damaging Het
Fam83g A G 11: 61,594,510 (GRCm39) I681M probably benign Het
Fastk T C 5: 24,650,139 (GRCm39) R3G probably damaging Het
Fxr1 A T 3: 34,112,196 (GRCm39) E367D probably damaging Het
Gatb A G 3: 85,518,677 (GRCm39) D261G probably damaging Het
Gm5617 T C 9: 48,407,117 (GRCm39) S84P possibly damaging Het
Hecw1 C T 13: 14,552,285 (GRCm39) E104K probably damaging Het
Il31ra T C 13: 112,680,422 (GRCm39) K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,331,410 (GRCm39) probably null Het
Lrp2 T A 2: 69,341,411 (GRCm39) D923V probably damaging Het
Ltn1 A G 16: 87,179,601 (GRCm39) L1520P probably damaging Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Map1s T G 8: 71,366,526 (GRCm39) V477G probably benign Het
Mical1 T C 10: 41,358,708 (GRCm39) L542P probably damaging Het
Mtcl3 T A 10: 29,072,395 (GRCm39) Y562* probably null Het
Mycbp2 T C 14: 103,446,329 (GRCm39) Y1800C probably damaging Het
Mylk A T 16: 34,806,846 (GRCm39) D1697V probably benign Het
Nlrp1a A T 11: 71,015,014 (GRCm39) F79I probably benign Het
Or52d3 T C 7: 104,228,848 (GRCm39) probably benign Het
Pde9a A G 17: 31,605,284 (GRCm39) Y6C probably damaging Het
Plxnd1 A T 6: 115,934,509 (GRCm39) I1808N probably damaging Het
Ppp1r13b T A 12: 111,800,167 (GRCm39) T537S probably benign Het
Ppp2r2a A G 14: 67,253,924 (GRCm39) F415L possibly damaging Het
Rabgap1 C T 2: 37,453,499 (GRCm39) R976* probably null Het
Rbfox3 T C 11: 118,387,842 (GRCm39) H195R probably damaging Het
Ripk4 A T 16: 97,544,933 (GRCm39) D571E probably damaging Het
Sdhaf4 T A 1: 24,044,634 (GRCm39) R16S probably benign Het
Slc17a1 G T 13: 24,059,658 (GRCm39) G130* probably null Het
Slc6a1 G T 6: 114,278,977 (GRCm39) A23S probably benign Het
Slco1a8 T C 6: 141,926,704 (GRCm39) I541V probably damaging Het
Spock1 T A 13: 57,583,952 (GRCm39) Q321L probably damaging Het
Syne2 A G 12: 75,999,560 (GRCm39) I2318V probably damaging Het
Terf2ip T C 8: 112,738,271 (GRCm39) V53A possibly damaging Het
Thrb T C 14: 18,033,487 (GRCm38) F403L probably benign Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Uqcrfs1 T C 13: 30,724,787 (GRCm39) K251R probably benign Het
Vmn2r114 T A 17: 23,510,737 (GRCm39) Y581F probably damaging Het
Vps13d A G 4: 144,874,909 (GRCm39) V1866A probably benign Het
Washc5 A T 15: 59,241,083 (GRCm39) F84Y probably damaging Het
Yars1 T A 4: 129,090,992 (GRCm39) Y28* probably null Het
Zfp638 A G 6: 83,905,964 (GRCm39) Y43C probably damaging Het
Zfp750 T A 11: 121,404,758 (GRCm39) H39L probably damaging Het
Zfr2 C A 10: 81,078,735 (GRCm39) S322R probably damaging Het
Zzef1 A G 11: 72,771,450 (GRCm39) D1644G probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGTGAAATGGAAACTGTCTAGG -3'
(R):5'- ATACTGCCCAGGCTCAGAAC -3'

Sequencing Primer
(F):5'- GCTAAGTTTCCATCCTTGTTAATGAG -3'
(R):5'- CCCAGGCTCAGAACAGGAAAAATATG -3'
Posted On 2014-10-01