Incidental Mutation 'R2134:Btnl1'
ID 233677
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms LOC240074, Btnl3, NG10, LOC240074
MMRRC Submission 040137-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2134 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34596106-34605002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34604608 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 463 (D463G)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect possibly damaging
Transcript: ENSMUST00000080254
AA Change: D463G

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: D463G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 109,921,743 (GRCm39) V1437E probably null Het
Adam12 G A 7: 133,614,017 (GRCm39) R80* probably null Het
Adgrb3 G T 1: 25,133,038 (GRCm39) F479L probably damaging Het
Atf7ip T A 6: 136,582,485 (GRCm39) V1165E possibly damaging Het
Atm C T 9: 53,379,264 (GRCm39) probably null Het
Atp11c A G X: 59,322,143 (GRCm39) Y593H probably damaging Het
Cdc34b T G 11: 94,633,252 (GRCm39) W151G probably damaging Het
Cdkal1 A G 13: 29,538,660 (GRCm39) S500P possibly damaging Het
Cenpf T C 1: 189,390,839 (GRCm39) N998D probably benign Het
Ces2e T A 8: 105,659,171 (GRCm39) probably null Het
Chd7 A G 4: 8,753,147 (GRCm39) Q548R probably damaging Het
Chfr T A 5: 110,292,627 (GRCm39) probably null Het
Clu A G 14: 66,212,290 (GRCm39) probably null Het
Cntnap5c A G 17: 58,714,717 (GRCm39) D1235G probably damaging Het
Col6a4 T C 9: 105,943,860 (GRCm39) S1205G probably benign Het
Ddx47 G T 6: 134,992,313 (GRCm39) E113* probably null Het
Dock4 A G 12: 40,795,667 (GRCm39) Y828C probably benign Het
Dync1h1 T A 12: 110,623,065 (GRCm39) N3553K possibly damaging Het
Egflam C T 15: 7,263,760 (GRCm39) C730Y probably damaging Het
Fam83b T C 9: 76,398,298 (GRCm39) Y935C probably damaging Het
Fam83g A G 11: 61,594,510 (GRCm39) I681M probably benign Het
Fastk T C 5: 24,650,139 (GRCm39) R3G probably damaging Het
Fxr1 A T 3: 34,112,196 (GRCm39) E367D probably damaging Het
Gatb A G 3: 85,518,677 (GRCm39) D261G probably damaging Het
Gm5617 T C 9: 48,407,117 (GRCm39) S84P possibly damaging Het
Hecw1 C T 13: 14,552,285 (GRCm39) E104K probably damaging Het
Il31ra T C 13: 112,680,422 (GRCm39) K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,331,410 (GRCm39) probably null Het
Lrp2 T A 2: 69,341,411 (GRCm39) D923V probably damaging Het
Ltn1 A G 16: 87,179,601 (GRCm39) L1520P probably damaging Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Map1s T G 8: 71,366,526 (GRCm39) V477G probably benign Het
Mical1 T C 10: 41,358,708 (GRCm39) L542P probably damaging Het
Mtcl3 T A 10: 29,072,395 (GRCm39) Y562* probably null Het
Mycbp2 T C 14: 103,446,329 (GRCm39) Y1800C probably damaging Het
Mylk A T 16: 34,806,846 (GRCm39) D1697V probably benign Het
Nlrp1a A T 11: 71,015,014 (GRCm39) F79I probably benign Het
Or52d3 T C 7: 104,228,848 (GRCm39) probably benign Het
Pde9a A G 17: 31,605,284 (GRCm39) Y6C probably damaging Het
Plxnd1 A T 6: 115,934,509 (GRCm39) I1808N probably damaging Het
Ppp1r13b T A 12: 111,800,167 (GRCm39) T537S probably benign Het
Ppp2r2a A G 14: 67,253,924 (GRCm39) F415L possibly damaging Het
Rabgap1 C T 2: 37,453,499 (GRCm39) R976* probably null Het
Rbfox3 T C 11: 118,387,842 (GRCm39) H195R probably damaging Het
Ripk4 A T 16: 97,544,933 (GRCm39) D571E probably damaging Het
Sdhaf4 T A 1: 24,044,634 (GRCm39) R16S probably benign Het
Slc17a1 G T 13: 24,059,658 (GRCm39) G130* probably null Het
Slc6a1 G T 6: 114,278,977 (GRCm39) A23S probably benign Het
Slco1a8 T C 6: 141,926,704 (GRCm39) I541V probably damaging Het
Spock1 T A 13: 57,583,952 (GRCm39) Q321L probably damaging Het
Syne2 A G 12: 75,999,560 (GRCm39) I2318V probably damaging Het
Terf2ip T C 8: 112,738,271 (GRCm39) V53A possibly damaging Het
Thrb T C 14: 18,033,487 (GRCm38) F403L probably benign Het
Tktl2 G A 8: 66,964,999 (GRCm39) V186M probably damaging Het
Uqcrfs1 T C 13: 30,724,787 (GRCm39) K251R probably benign Het
Vmn2r111 T C 17: 22,792,085 (GRCm39) E57G possibly damaging Het
Vmn2r114 T A 17: 23,510,737 (GRCm39) Y581F probably damaging Het
Vps13d A G 4: 144,874,909 (GRCm39) V1866A probably benign Het
Washc5 A T 15: 59,241,083 (GRCm39) F84Y probably damaging Het
Yars1 T A 4: 129,090,992 (GRCm39) Y28* probably null Het
Zfp638 A G 6: 83,905,964 (GRCm39) Y43C probably damaging Het
Zfp750 T A 11: 121,404,758 (GRCm39) H39L probably damaging Het
Zfr2 C A 10: 81,078,735 (GRCm39) S322R probably damaging Het
Zzef1 A G 11: 72,771,450 (GRCm39) D1644G probably benign Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34,600,091 (GRCm39) missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34,604,659 (GRCm39) missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34,598,509 (GRCm39) missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34,601,239 (GRCm39) missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34,604,486 (GRCm39) missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34,600,030 (GRCm39) missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0371:Btnl1 UTSW 17 34,600,031 (GRCm39) missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34,600,182 (GRCm39) nonsense probably null
R1982:Btnl1 UTSW 17 34,598,725 (GRCm39) missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34,598,578 (GRCm39) missense probably damaging 1.00
R2760:Btnl1 UTSW 17 34,600,012 (GRCm39) missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34,600,133 (GRCm39) missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34,601,436 (GRCm39) missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34,598,699 (GRCm39) missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34,598,725 (GRCm39) missense probably null 0.99
R5579:Btnl1 UTSW 17 34,600,526 (GRCm39) critical splice donor site probably null
R5811:Btnl1 UTSW 17 34,604,503 (GRCm39) missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R6602:Btnl1 UTSW 17 34,604,722 (GRCm39) missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34,604,305 (GRCm39) missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34,604,647 (GRCm39) missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34,599,014 (GRCm39) splice site probably null
R8840:Btnl1 UTSW 17 34,604,577 (GRCm39) missense probably benign 0.17
R9120:Btnl1 UTSW 17 34,598,681 (GRCm39) missense possibly damaging 0.85
R9515:Btnl1 UTSW 17 34,600,118 (GRCm39) missense probably benign 0.00
R9528:Btnl1 UTSW 17 34,603,352 (GRCm39) missense possibly damaging 0.91
R9577:Btnl1 UTSW 17 34,603,335 (GRCm39) missense probably benign 0.16
RF041:Btnl1 UTSW 17 34,600,342 (GRCm39) missense probably benign 0.04
X0026:Btnl1 UTSW 17 34,596,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAAGGCTTCATGTTGGG -3'
(R):5'- ACCCATTGAATTCCCTGTGC -3'

Sequencing Primer
(F):5'- ACACTAGGAGTTTATGAGCTGTGCAC -3'
(R):5'- TGTGCACATCACTTAGGGC -3'
Posted On 2014-10-01