Mutagenetix > Incidental Mutation

Incidental Mutation 'R2145:Ptprc'

233691

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

040148-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2145 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 138073681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 780 (Y780C)

Ref Sequence

ENSEMBL: ENSMUSP00000138275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]

AlphaFold

P06800

Predicted Effect

probably damaging
Transcript: ENSMUST00000027645
AA Change: Y941C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027645
Gene: ENSMUSG00000026395
AA Change: Y941C

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5e-16	PFAM
low complexity region	109	126	N/A	INTRINSIC
low complexity region	168	203	N/A	INTRINSIC
Pfam:CD45	210	267	3.1e-20	PFAM
FN3	372	456	2.28e0	SMART
FN3	472	550	3.48e-1	SMART
transmembrane domain	565	586	N/A	INTRINSIC
PTPc	639	901	7.57e-127	SMART
PTPc	930	1216	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112036

SMART Domains

Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182283
AA Change: Y804C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: Y804C

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182755
AA Change: Y780C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: Y780C

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183301
AA Change: Y943C

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: Y943C

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Meta Mutation Damage Score

0.4922

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	T	C	9: 50,764,874	Y32C	probably damaging	Het
Abca15	A	G	7: 120,354,478	N535S	probably benign	Het
Abcc6	A	T	7: 45,998,741	L717Q	probably benign	Het
Abraxas2	C	A	7: 132,883,061	Q278K	probably benign	Het
Acap2	A	T	16: 31,105,524	D637E	probably benign	Het
AI661453	A	G	17: 47,466,098		probably benign	Het
Aoah	A	T	13: 20,840,096	E74V	probably damaging	Het
Appl1	A	G	14: 26,949,619	L292S	possibly damaging	Het
Astl	T	A	2: 127,347,189	V166E	probably damaging	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bbs1	T	G	19: 4,903,707	K143Q	possibly damaging	Het
Bbx	T	C	16: 50,274,544		probably benign	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
C1qtnf2	T	G	11: 43,490,984	F178V	probably damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Clcn7	A	G	17: 25,144,451	I34V	probably benign	Het
Cntn5	G	T	9: 9,748,415	P487Q	probably damaging	Het
Ctu2	T	A	8: 122,479,152	I213K	probably benign	Het
Des	C	A	1: 75,363,464		probably benign	Het
Dgcr8	A	T	16: 18,280,230	D432E	probably benign	Het
Dlgap5	G	A	14: 47,395,923	R549*	probably null	Het
Dmxl2	T	C	9: 54,415,910	T1397A	probably damaging	Het
Dnmt1	T	A	9: 20,937,155		probably benign	Het
Doxl2	A	T	6: 48,976,695	D518V	probably damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dtwd1	C	A	2: 126,159,984	T208N	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Dync1i2	T	A	2: 71,214,563		probably benign	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Fmod	T	C	1: 134,040,518	Y99H	probably benign	Het
Fn1	A	T	1: 71,606,004	V1552D	probably damaging	Het
Fnip2	A	T	3: 79,500,432	S281T	probably damaging	Het
Glb1	A	G	9: 114,464,165	H536R	probably benign	Het
Glis2	T	A	16: 4,613,642	S344R	possibly damaging	Het
Gm1966	T	A	7: 106,603,008	H343L	possibly damaging	Het
Gm4847	A	T	1: 166,634,903	S339R	probably benign	Het
Gpr155	A	G	2: 73,356,658	S44P	probably benign	Het
Gprin1	G	A	13: 54,738,632	P610S	probably damaging	Het
H2-Ob	A	T	17: 34,242,580	M98L	probably benign	Het
Hist1h3e	T	C	13: 23,562,356	T4A	probably benign	Het
Hmcn2	T	C	2: 31,333,931		probably benign	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Il13	T	C	11: 53,632,524	T85A	possibly damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Irgm2	T	C	11: 58,220,529	S361P	possibly damaging	Het
Itga11	C	T	9: 62,732,204		probably benign	Het
Kalrn	G	T	16: 34,009,262		probably benign	Het
Kcng1	C	A	2: 168,269,032	G71C	probably damaging	Het
Kcnq5	T	A	1: 21,505,349	D291V	probably damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Letm1	A	AG	5: 33,769,515		probably null	Het
Lhx6	C	T	2: 36,087,466	V325I	probably benign	Het
Lipc	A	G	9: 70,934,535	I9T	possibly damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mast1	C	A	8: 84,921,478	G458V	probably damaging	Het
Mga	T	C	2: 119,964,157	V2565A	possibly damaging	Het
Mkl2	T	C	16: 13,412,586	I1045T	probably damaging	Het
Mpzl2	C	G	9: 45,044,173	D127E	probably benign	Het
Myh3	T	A	11: 67,091,056	C793S	probably benign	Het
Nomo1	T	C	7: 46,066,504	L765P	probably damaging	Het
Nup210	A	G	6: 91,028,876	I1335T	possibly damaging	Het
Olfr549	T	C	7: 102,555,060		probably null	Het
Oxr1	T	A	15: 41,819,944	S254R	probably damaging	Het
Pan3	A	G	5: 147,530,098	I592V	possibly damaging	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pex2	T	C	3: 5,561,590	E53G	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Phactr4	T	C	4: 132,370,784	E391G	probably damaging	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Pkhd1l1	A	T	15: 44,512,877		probably null	Het
Pnlip	A	G	19: 58,676,444	S235G	probably benign	Het
Prkd1	A	G	12: 50,489,911	V130A	possibly damaging	Het
Ptpn13	A	G	5: 103,556,133	T1344A	probably benign	Het
Pxn	T	A	5: 115,552,756		probably benign	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rc3h1	G	T	1: 160,930,257	K48N	probably damaging	Het
Rfwd3	T	C	8: 111,282,613	I444V	probably benign	Het
Rictor	C	T	15: 6,765,107	R293C	probably damaging	Het
Rif1	T	A	2: 52,111,400	I1622N	possibly damaging	Het
Rnf213	T	C	11: 119,415,193	V609A	probably benign	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Serac1	A	T	17: 6,050,785	I448N	probably damaging	Het
Sh3kbp1	C	A	X: 159,824,496	T200K	probably benign	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
Socs7	T	C	11: 97,373,124	F281L	probably benign	Het
Spta1	C	T	1: 174,212,614	L1214F	probably benign	Het
Ssu72	A	G	4: 155,705,443	E21G	probably damaging	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tmem130	C	A	5: 144,743,785	V270L	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Tspyl2	A	T	X: 152,338,894	D572E	probably benign	Het
Unc45b	G	A	11: 82,917,754	R222H	probably benign	Het
Uxs1	T	C	1: 43,827,623	Y29C	probably damaging	Het
Virma	T	A	4: 11,548,726		probably benign	Het
Vmn1r202	C	T	13: 22,501,783	G155S	possibly damaging	Het
Vmn2r24	T	A	6: 123,779,013	F15I	probably benign	Het
Wdr64	A	G	1: 175,767,095	T471A	probably benign	Het
Zfa-ps	T	A	10: 52,543,277		noncoding transcript	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp821	A	G	8: 109,724,347	D324G	probably damaging	Het
Zfp934	T	C	13: 62,517,834	D331G	probably damaging	Het
Zscan29	T	C	2: 121,170,106	R7G	probably damaging	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
Benighted	UTSW	1	138126301	critical splice donor site	probably null
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fluorescent	UTSW	1	138101192	missense	probably damaging	0.97
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
petechiae	UTSW	1	138113708	nonsense	probably null
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	splice site	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
R8677:Ptprc	UTSW	1	138083597	missense	probably damaging	1.00
R8704:Ptprc	UTSW	1	138115624	missense	probably benign	0.34
R8824:Ptprc	UTSW	1	138113708	nonsense	probably null
R8921:Ptprc	UTSW	1	138126301	critical splice donor site	probably null
R8998:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R8999:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R9154:Ptprc	UTSW	1	138088564	missense	probably damaging	1.00
R9388:Ptprc	UTSW	1	138083642	missense	possibly damaging	0.87
R9428:Ptprc	UTSW	1	138113747	missense	probably benign	0.01
R9467:Ptprc	UTSW	1	138066222	missense	probably damaging	1.00
R9468:Ptprc	UTSW	1	138117016	missense	probably benign	0.01
R9479:Ptprc	UTSW	1	138073650	missense	probably benign	0.38
R9526:Ptprc	UTSW	1	138068373	missense	probably benign	0.02
R9632:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9710:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9714:Ptprc	UTSW	1	138080949	missense	probably damaging	1.00
R9777:Ptprc	UTSW	1	138120163	missense
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAGGGTCACTTCATAGTCCATG -3'
(R):5'- AGTCCCAGCTCAGCAATTC -3'

Sequencing Primer
(F):5'- GGGTCACTTCATAGTCCATGTCTTAC -3'
(R):5'- TCTGTGGACTCAGAGACTGAAC -3'

Posted On

2014-10-01