Incidental Mutation 'R2145:Mga'
ID233702
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene NameMAX gene associated
SynonymsD030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission 040148-MU
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R2145 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119897228-119969581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119964157 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2565 (V2565A)
Ref Sequence ENSEMBL: ENSMUSP00000078853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
Predicted Effect probably benign
Transcript: ENSMUST00000046717
AA Change: V2735A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: V2735A

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079934
AA Change: V2565A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: V2565A

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110773
AA Change: V2656A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: V2656A

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110774
AA Change: V2774A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: V2774A

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131396
Predicted Effect probably benign
Transcript: ENSMUST00000156510
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7286:Mga UTSW 2 119964788 missense possibly damaging 0.93
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
R7537:Mga UTSW 2 119935551 missense probably damaging 0.97
R7781:Mga UTSW 2 119917357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCAGCACAGGAATTTATACC -3'
(R):5'- GTTCCCAGGAGCAAGTTTACTG -3'

Sequencing Primer
(F):5'- CCTAAAAATATGTCTGGTGATGTGAG -3'
(R):5'- GCTGAGCATCTCCTGAGAATTCTG -3'
Posted On2014-10-01