Incidental Mutation 'R2145:Pxn'
ID233718
Institutional Source Beutler Lab
Gene Symbol Pxn
Ensembl Gene ENSMUSG00000029528
Gene Namepaxillin
SynonymsPax
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2145 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115506676-115555987 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 115552756 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067268] [ENSMUST00000086523] [ENSMUST00000202564] [ENSMUST00000212819]
Predicted Effect probably benign
Transcript: ENSMUST00000067268
SMART Domains Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 1.6e-98 PFAM
low complexity region 281 300 N/A INTRINSIC
LIM 323 374 3.99e-23 SMART
LIM 382 433 2.36e-16 SMART
LIM 441 492 8.16e-20 SMART
LIM 500 551 8.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086523
SMART Domains Protein: ENSMUSP00000083709
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 4.8e-97 PFAM
low complexity region 315 334 N/A INTRINSIC
LIM 357 408 3.99e-23 SMART
LIM 416 467 2.36e-16 SMART
LIM 475 526 8.16e-20 SMART
LIM 534 585 8.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152156
Predicted Effect probably benign
Transcript: ENSMUST00000202564
SMART Domains Protein: ENSMUSP00000144459
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 5.8e-59 PFAM
low complexity region 148 167 N/A INTRINSIC
LIM 190 241 1.9e-25 SMART
LIM 249 300 1.1e-18 SMART
LIM 308 359 4e-22 SMART
LIM 367 418 4.4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212819
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice die at E9.5 with defects in the amnion, allantois, and headfold structures, as well as impaired growth, and abnormal heart and somite development; mutant fibroblasts show aberrant fibronectin-regulated focal adhesion dynamics, and disorganized membrane cytoskeletal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Pxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Pxn APN 5 115544926 missense probably benign 0.00
IGL02432:Pxn APN 5 115545746 missense probably damaging 1.00
IGL02454:Pxn APN 5 115552266 missense probably damaging 1.00
R0316:Pxn UTSW 5 115553968 missense probably damaging 1.00
R0778:Pxn UTSW 5 115552177 missense probably damaging 1.00
R1680:Pxn UTSW 5 115552147 missense probably damaging 1.00
R1874:Pxn UTSW 5 115544990 missense probably damaging 1.00
R2069:Pxn UTSW 5 115545667 missense probably benign 0.26
R4124:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4126:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4127:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4551:Pxn UTSW 5 115552720 unclassified probably benign
R4717:Pxn UTSW 5 115551942 missense probably damaging 0.99
R5217:Pxn UTSW 5 115544915 missense probably benign 0.13
R5332:Pxn UTSW 5 115544369 missense probably damaging 1.00
R5635:Pxn UTSW 5 115551492 missense probably benign
R5681:Pxn UTSW 5 115544534 missense possibly damaging 0.94
R6629:Pxn UTSW 5 115554062 missense probably damaging 1.00
R6702:Pxn UTSW 5 115551896 missense probably benign 0.11
R7516:Pxn UTSW 5 115506863 missense unknown
R7671:Pxn UTSW 5 115548547 missense not run
R7749:Pxn UTSW 5 115548516 missense probably benign 0.00
R7866:Pxn UTSW 5 115548606 missense possibly damaging 0.85
R8196:Pxn UTSW 5 115545709 missense probably damaging 0.99
R8244:Pxn UTSW 5 115552243 missense probably damaging 1.00
X0018:Pxn UTSW 5 115545732 missense probably damaging 1.00
X0025:Pxn UTSW 5 115546895 missense probably damaging 0.97
X0065:Pxn UTSW 5 115551487 critical splice acceptor site probably null
Z1177:Pxn UTSW 5 115553893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCGTGAGTTTGAGCTC -3'
(R):5'- ATTCAGAGGTAGACCCAGAGC -3'

Sequencing Primer
(F):5'- TGAGCTCGAAGTTTGAGGAG -3'
(R):5'- GTAGACCCAGAGCCACCCTG -3'
Posted On2014-10-01