Incidental Mutation 'R2145:Ctu2'
ID233739
Institutional Source Beutler Lab
Gene Symbol Ctu2
Ensembl Gene ENSMUSG00000049482
Gene Namecytosolic thiouridylase subunit 2
Synonyms2310061F22Rik
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2145 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122476143-122484138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122479152 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 213 (I213K)
Ref Sequence ENSEMBL: ENSMUSP00000119237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014614] [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000134127] [ENSMUST00000136253] [ENSMUST00000151855] [ENSMUST00000156333] [ENSMUST00000146634]
Predicted Effect probably benign
Transcript: ENSMUST00000014614
SMART Domains Protein: ENSMUSP00000014614
Gene: ENSMUSG00000014470

DomainStartEndE-ValueType
RING 33 72 3.29e-5 SMART
ZnF_C2H2 150 173 7.05e-1 SMART
ZnF_C2H2 180 208 9.56e1 SMART
low complexity region 222 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067252
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
AA Change: I238K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482
AA Change: I238K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126553
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131934
Predicted Effect probably benign
Transcript: ENSMUST00000134127
AA Change: I213K

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119237
Gene: ENSMUSG00000049482
AA Change: I213K

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
SCOP:d1sur__ 25 128 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134304
Predicted Effect probably benign
Transcript: ENSMUST00000136253
Predicted Effect probably benign
Transcript: ENSMUST00000151855
AA Change: I238K

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482
AA Change: I238K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149925
Predicted Effect probably benign
Transcript: ENSMUST00000212499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154099
Predicted Effect probably benign
Transcript: ENSMUST00000156333
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146634
SMART Domains Protein: ENSMUSP00000119931
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 78 87 N/A INTRINSIC
low complexity region 96 104 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs). The encoded protein plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Ctu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ctu2 APN 8 122477238 unclassified probably benign
IGL01764:Ctu2 APN 8 122479422 unclassified probably benign
IGL02190:Ctu2 APN 8 122481658 utr 3 prime probably benign
IGL02869:Ctu2 APN 8 122478791 splice site probably null
IGL03136:Ctu2 APN 8 122479201 unclassified probably benign
IGL03139:Ctu2 APN 8 122478707 missense possibly damaging 0.65
IGL03237:Ctu2 APN 8 122479053 missense probably benign 0.00
PIT4354001:Ctu2 UTSW 8 122478975 missense probably damaging 0.99
R0001:Ctu2 UTSW 8 122478920 missense probably benign
R0359:Ctu2 UTSW 8 122478193 missense probably damaging 0.99
R1078:Ctu2 UTSW 8 122481499 missense possibly damaging 0.69
R1938:Ctu2 UTSW 8 122479285 missense probably damaging 1.00
R2143:Ctu2 UTSW 8 122479152 missense probably benign 0.16
R2221:Ctu2 UTSW 8 122480910 missense probably damaging 1.00
R4111:Ctu2 UTSW 8 122476517 missense possibly damaging 0.64
R4284:Ctu2 UTSW 8 122478239 missense probably benign 0.04
R4704:Ctu2 UTSW 8 122479303 missense probably damaging 1.00
R4774:Ctu2 UTSW 8 122481112 missense probably benign 0.17
R5254:Ctu2 UTSW 8 122476588 missense probably damaging 1.00
R5804:Ctu2 UTSW 8 122481226 critical splice donor site probably null
R5935:Ctu2 UTSW 8 122476954 unclassified probably benign
R7378:Ctu2 UTSW 8 122481499 missense probably damaging 0.99
R7911:Ctu2 UTSW 8 122480994 missense probably benign 0.01
R8546:Ctu2 UTSW 8 122479363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATGCTGCACTTCCCAG -3'
(R):5'- ACCTTGCAATAGCCATGGACTC -3'

Sequencing Primer
(F):5'- ATGCTGCACTTCCCAGGAGTC -3'
(R):5'- TAGCCATGGACTCGGGCTATG -3'
Posted On2014-10-01