Mutagenetix > Incidental Mutations

Incidental Mutation 'R2145:Cntn5'

233740

Institutional Source

Beutler Lab

Gene Symbol

Cntn5

Ensembl Gene

ENSMUSG00000039488

Gene Name

contactin 5

Synonyms

NB-2, LOC244683, 6720426O10Rik, A830025P08Rik

MMRRC Submission

040148-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2145 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9660891-10904775 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 9748415 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 487 (P487Q)

Ref Sequence

ENSEMBL: ENSMUSP00000135903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074133
AA Change: P692Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: P692Q

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	113	179	1.11e-10	SMART
IG	201	289	4.82e-6	SMART
IGc2	312	375	1.4e-16	SMART
IGc2	401	464	8.97e-15	SMART
IGc2	493	557	4.96e-8	SMART
IG	577	667	2.13e-7	SMART
FN3	670	756	1.01e-11	SMART
FN3	773	859	9.19e-1	SMART
FN3	875	958	3.99e-10	SMART
FN3	974	1053	1.68e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160216
AA Change: P692Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: P692Q

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	113	179	1.11e-10	SMART
IG	201	289	4.82e-6	SMART
IGc2	312	375	1.4e-16	SMART
IGc2	401	464	8.97e-15	SMART
IGc2	493	557	4.96e-8	SMART
IG	577	667	2.13e-7	SMART
FN3	670	756	1.01e-11	SMART
FN3	773	859	9.19e-1	SMART
FN3	875	958	3.99e-10	SMART
FN3	974	1053	1.68e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162484
AA Change: P487Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: P487Q

Domain	Start	End	E-Value	Type
IG_like	10	84	1.12e2	SMART
IGc2	107	170	1.4e-16	SMART
IGc2	196	259	8.97e-15	SMART
IGc2	288	352	4.96e-8	SMART
IG	372	462	2.13e-7	SMART
FN3	465	551	1.01e-11	SMART
FN3	568	654	9.19e-1	SMART
FN3	670	753	3.99e-10	SMART
FN3	769	848	1.68e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179049
AA Change: P487Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: P487Q

Domain	Start	End	E-Value	Type
IG_like	10	84	1.12e2	SMART
IGc2	107	170	1.4e-16	SMART
IGc2	196	259	8.97e-15	SMART
IGc2	288	352	4.96e-8	SMART
IG	372	462	2.13e-7	SMART
FN3	465	551	1.01e-11	SMART
FN3	568	654	9.19e-1	SMART
FN3	670	753	3.99e-10	SMART
FN3	769	848	1.68e-3	SMART

Meta Mutation Damage Score

0.1562

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	T	C	9: 50,764,874	Y32C	probably damaging	Het
Abca15	A	G	7: 120,354,478	N535S	probably benign	Het
Abcc6	A	T	7: 45,998,741	L717Q	probably benign	Het
Abraxas2	C	A	7: 132,883,061	Q278K	probably benign	Het
Acap2	A	T	16: 31,105,524	D637E	probably benign	Het
AI661453	A	G	17: 47,466,098		probably benign	Het
Aoah	A	T	13: 20,840,096	E74V	probably damaging	Het
Appl1	A	G	14: 26,949,619	L292S	possibly damaging	Het
Astl	T	A	2: 127,347,189	V166E	probably damaging	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bbs1	T	G	19: 4,903,707	K143Q	possibly damaging	Het
Bbx	T	C	16: 50,274,544		probably benign	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
C1qtnf2	T	G	11: 43,490,984	F178V	probably damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Clcn7	A	G	17: 25,144,451	I34V	probably benign	Het
Ctu2	T	A	8: 122,479,152	I213K	probably benign	Het
Des	C	A	1: 75,363,464		probably benign	Het
Dgcr8	A	T	16: 18,280,230	D432E	probably benign	Het
Dlgap5	G	A	14: 47,395,923	R549*	probably null	Het
Dmxl2	T	C	9: 54,415,910	T1397A	probably damaging	Het
Dnmt1	T	A	9: 20,937,155		probably benign	Het
Doxl2	A	T	6: 48,976,695	D518V	probably damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dtwd1	C	A	2: 126,159,984	T208N	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Dync1i2	T	A	2: 71,214,563		probably benign	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Fmod	T	C	1: 134,040,518	Y99H	probably benign	Het
Fn1	A	T	1: 71,606,004	V1552D	probably damaging	Het
Fnip2	A	T	3: 79,500,432	S281T	probably damaging	Het
Glb1	A	G	9: 114,464,165	H536R	probably benign	Het
Glis2	T	A	16: 4,613,642	S344R	possibly damaging	Het
Gm1966	T	A	7: 106,603,008	H343L	possibly damaging	Het
Gm4847	A	T	1: 166,634,903	S339R	probably benign	Het
Gpr155	A	G	2: 73,356,658	S44P	probably benign	Het
Gprin1	G	A	13: 54,738,632	P610S	probably damaging	Het
H2-Ob	A	T	17: 34,242,580	M98L	probably benign	Het
Hist1h3e	T	C	13: 23,562,356	T4A	probably benign	Het
Hmcn2	T	C	2: 31,333,931		probably benign	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Il13	T	C	11: 53,632,524	T85A	possibly damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Irgm2	T	C	11: 58,220,529	S361P	possibly damaging	Het
Itga11	C	T	9: 62,732,204		probably benign	Het
Kalrn	G	T	16: 34,009,262		probably benign	Het
Kcng1	C	A	2: 168,269,032	G71C	probably damaging	Het
Kcnq5	T	A	1: 21,505,349	D291V	probably damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Letm1	A	AG	5: 33,769,515		probably null	Het
Lhx6	C	T	2: 36,087,466	V325I	probably benign	Het
Lipc	A	G	9: 70,934,535	I9T	possibly damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mast1	C	A	8: 84,921,478	G458V	probably damaging	Het
Mga	T	C	2: 119,964,157	V2565A	possibly damaging	Het
Mkl2	T	C	16: 13,412,586	I1045T	probably damaging	Het
Mpzl2	C	G	9: 45,044,173	D127E	probably benign	Het
Myh3	T	A	11: 67,091,056	C793S	probably benign	Het
Nomo1	T	C	7: 46,066,504	L765P	probably damaging	Het
Nup210	A	G	6: 91,028,876	I1335T	possibly damaging	Het
Olfr549	T	C	7: 102,555,060		probably null	Het
Oxr1	T	A	15: 41,819,944	S254R	probably damaging	Het
Pan3	A	G	5: 147,530,098	I592V	possibly damaging	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pex2	T	C	3: 5,561,590	E53G	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Phactr4	T	C	4: 132,370,784	E391G	probably damaging	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Pkhd1l1	A	T	15: 44,512,877		probably null	Het
Pnlip	A	G	19: 58,676,444	S235G	probably benign	Het
Prkd1	A	G	12: 50,489,911	V130A	possibly damaging	Het
Ptpn13	A	G	5: 103,556,133	T1344A	probably benign	Het
Ptprc	T	C	1: 138,073,681	Y780C	probably damaging	Het
Pxn	T	A	5: 115,552,756		probably benign	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rc3h1	G	T	1: 160,930,257	K48N	probably damaging	Het
Rfwd3	T	C	8: 111,282,613	I444V	probably benign	Het
Rictor	C	T	15: 6,765,107	R293C	probably damaging	Het
Rif1	T	A	2: 52,111,400	I1622N	possibly damaging	Het
Rnf213	T	C	11: 119,415,193	V609A	probably benign	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Serac1	A	T	17: 6,050,785	I448N	probably damaging	Het
Sh3kbp1	C	A	X: 159,824,496	T200K	probably benign	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
Socs7	T	C	11: 97,373,124	F281L	probably benign	Het
Spta1	C	T	1: 174,212,614	L1214F	probably benign	Het
Ssu72	A	G	4: 155,705,443	E21G	probably damaging	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tmem130	C	A	5: 144,743,785	V270L	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Tspyl2	A	T	X: 152,338,894	D572E	probably benign	Het
Unc45b	G	A	11: 82,917,754	R222H	probably benign	Het
Uxs1	T	C	1: 43,827,623	Y29C	probably damaging	Het
Virma	T	A	4: 11,548,726		probably benign	Het
Vmn1r202	C	T	13: 22,501,783	G155S	possibly damaging	Het
Vmn2r24	T	A	6: 123,779,013	F15I	probably benign	Het
Wdr64	A	G	1: 175,767,095	T471A	probably benign	Het
Zfa-ps	T	A	10: 52,543,277		noncoding transcript	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp821	A	G	8: 109,724,347	D324G	probably damaging	Het
Zfp934	T	C	13: 62,517,834	D331G	probably damaging	Het
Zscan29	T	C	2: 121,170,106	R7G	probably damaging	Het

Other mutations in Cntn5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Cntn5	APN	9	9976297	missense	probably damaging	0.99
IGL01118:Cntn5	APN	9	9831560	missense	possibly damaging	0.94
IGL01328:Cntn5	APN	9	9781768	missense	probably damaging	1.00
IGL01445:Cntn5	APN	9	9693484	splice site	probably benign
IGL01505:Cntn5	APN	9	9706087	missense	probably damaging	1.00
IGL01556:Cntn5	APN	9	9673908	missense	probably benign
IGL01804:Cntn5	APN	9	9831537	missense	probably damaging	0.99
IGL02173:Cntn5	APN	9	9748396	missense	probably damaging	1.00
IGL02250:Cntn5	APN	9	10145331	missense	probably damaging	1.00
IGL02366:Cntn5	APN	9	9984055	splice site	probably benign
IGL02565:Cntn5	APN	9	10145338	nonsense	probably null
IGL02593:Cntn5	APN	9	9833499	missense	probably damaging	1.00
IGL02743:Cntn5	APN	9	9984110	missense	probably damaging	1.00
IGL02976:Cntn5	APN	9	10419099	unclassified	probably benign
IGL03103:Cntn5	APN	9	9972812	splice site	probably benign
IGL03114:Cntn5	APN	9	9748452	missense	probably damaging	1.00
IGL03156:Cntn5	APN	9	9673877	missense	probably damaging	1.00
IGL02802:Cntn5	UTSW	9	10048678	splice site	probably null
R0243:Cntn5	UTSW	9	9781775	missense	probably damaging	1.00
R0385:Cntn5	UTSW	9	9972870	missense	probably damaging	1.00
R0541:Cntn5	UTSW	9	9673402	splice site	probably benign
R0827:Cntn5	UTSW	9	9666938	missense	possibly damaging	0.88
R1029:Cntn5	UTSW	9	9831572	missense	probably damaging	1.00
R1440:Cntn5	UTSW	9	10145339	missense	probably damaging	1.00
R1463:Cntn5	UTSW	9	9673796	critical splice donor site	probably null
R1536:Cntn5	UTSW	9	9976316	missense	possibly damaging	0.78
R1746:Cntn5	UTSW	9	9831572	missense	probably damaging	1.00
R1761:Cntn5	UTSW	9	10172054	missense	probably benign	0.01
R1764:Cntn5	UTSW	9	9673983	missense	probably benign
R1859:Cntn5	UTSW	9	9972834	missense	probably damaging	1.00
R1888:Cntn5	UTSW	9	9984077	missense	possibly damaging	0.95
R1888:Cntn5	UTSW	9	9984077	missense	possibly damaging	0.95
R1950:Cntn5	UTSW	9	9781769	missense	probably damaging	1.00
R2143:Cntn5	UTSW	9	9748415	missense	probably damaging	0.98
R2437:Cntn5	UTSW	9	10048753	nonsense	probably null
R2440:Cntn5	UTSW	9	10171955	missense	possibly damaging	0.91
R2504:Cntn5	UTSW	9	10172121	missense	probably benign
R3054:Cntn5	UTSW	9	10419071	missense	probably benign	0.30
R3056:Cntn5	UTSW	9	10419071	missense	probably benign	0.30
R3804:Cntn5	UTSW	9	9781663	splice site	probably benign
R4164:Cntn5	UTSW	9	9781676	missense	probably damaging	1.00
R4444:Cntn5	UTSW	9	9704942	missense	probably damaging	1.00
R4472:Cntn5	UTSW	9	10048771	missense	probably damaging	1.00
R4576:Cntn5	UTSW	9	9673292	missense	probably benign	0.10
R4624:Cntn5	UTSW	9	9704804	nonsense	probably null
R4652:Cntn5	UTSW	9	9704912	missense	possibly damaging	0.68
R4664:Cntn5	UTSW	9	10144209	missense	possibly damaging	0.71
R4679:Cntn5	UTSW	9	9970531	missense	probably benign	0.09
R4829:Cntn5	UTSW	9	9976283	missense	probably damaging	1.00
R4929:Cntn5	UTSW	9	9976395	critical splice acceptor site	probably null
R5211:Cntn5	UTSW	9	9704889	missense	possibly damaging	0.88
R5406:Cntn5	UTSW	9	9833460	missense	probably damaging	1.00
R5468:Cntn5	UTSW	9	9743628	missense	probably damaging	1.00
R5584:Cntn5	UTSW	9	9661452	missense	possibly damaging	0.91
R5688:Cntn5	UTSW	9	9748422	missense	probably damaging	1.00
R5762:Cntn5	UTSW	9	9748389	missense	possibly damaging	0.95
R6141:Cntn5	UTSW	9	10144157	missense	probably benign
R6147:Cntn5	UTSW	9	10012889	missense	probably damaging	0.98
R6325:Cntn5	UTSW	9	10144323	intron	probably null
R6377:Cntn5	UTSW	9	9743652	missense	probably damaging	1.00
R6774:Cntn5	UTSW	9	10144217	missense	probably damaging	1.00
R7117:Cntn5	UTSW	9	10904699	start gained	probably benign
R7252:Cntn5	UTSW	9	9831635	missense	probably benign	0.00
R7363:Cntn5	UTSW	9	10172016	missense	probably benign	0.00
R7401:Cntn5	UTSW	9	9833461	missense	probably benign	0.13
R7488:Cntn5	UTSW	9	9970565	missense	probably damaging	0.99
R7548:Cntn5	UTSW	9	9673410	intron	probably null
R7662:Cntn5	UTSW	9	9661385	missense	probably benign	0.17
R7718:Cntn5	UTSW	9	9984128	missense	probably benign
R7719:Cntn5	UTSW	9	9704898	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAAGTAGTTGACCATGATCAATG -3'
(R):5'- GTTTAGGCAAACACATCATCTCATG -3'

Sequencing Primer
(F):5'- GTTGACCATGATCAATGTTGTAAAG -3'
(R):5'- CATCATCTCATGAGATCCACATTGG -3'

Posted On

2014-10-01