Incidental Mutation 'R2145:Rictor'
ID233771
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2145 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6765107 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 293 (R293C)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably damaging
Transcript: ENSMUST00000061656
AA Change: R293C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: R293C

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228918
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
Tense UTSW 15 6759496 missense possibly damaging 0.94
Tonus UTSW 15 6769334 critical splice donor site probably null
Torrid UTSW 15 6759572 missense probably damaging 1.00
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
R7616:Rictor UTSW 15 6772154 missense probably benign 0.27
R7620:Rictor UTSW 15 6772154 missense probably benign 0.27
R7643:Rictor UTSW 15 6769269 nonsense probably null
R7699:Rictor UTSW 15 6772154 missense probably benign 0.27
R7700:Rictor UTSW 15 6772154 missense probably benign 0.27
R7749:Rictor UTSW 15 6772154 missense probably benign 0.27
R7750:Rictor UTSW 15 6772154 missense probably benign 0.27
R7751:Rictor UTSW 15 6772154 missense probably benign 0.27
R7753:Rictor UTSW 15 6772154 missense probably benign 0.27
R7841:Rictor UTSW 15 6772154 missense probably benign 0.27
R7894:Rictor UTSW 15 6772154 missense probably benign 0.27
R7897:Rictor UTSW 15 6772154 missense probably benign 0.27
R7898:Rictor UTSW 15 6772154 missense probably benign 0.27
R7937:Rictor UTSW 15 6772154 missense probably benign 0.27
R7944:Rictor UTSW 15 6772154 missense probably benign 0.27
R8062:Rictor UTSW 15 6772154 missense probably benign 0.27
R8063:Rictor UTSW 15 6772154 missense probably benign 0.27
R8094:Rictor UTSW 15 6772154 missense probably benign 0.27
R8119:Rictor UTSW 15 6772154 missense probably benign 0.27
R8134:Rictor UTSW 15 6772154 missense probably benign 0.27
R8166:Rictor UTSW 15 6769334 critical splice donor site probably null
R8324:Rictor UTSW 15 6745562 missense probably damaging 1.00
R8343:Rictor UTSW 15 6778319 critical splice donor site probably null
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTTAGAGTAGACCTGGTC -3'
(R):5'- AACTCAGAATACAGGATGCAGTATC -3'

Sequencing Primer
(F):5'- GAGTAGACCTGGTCTTTTTCAGAAC -3'
(R):5'- TCTCCTTGACTACCATACAT -3'
Posted On2014-10-01