Incidental Mutation 'R2145:Clcn7'
ID233781
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Namechloride channel, voltage-sensitive 7
SynonymsClC-7
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2145 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25133391-25162104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25144451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 34 (I34V)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]
Predicted Effect probably benign
Transcript: ENSMUST00000040729
AA Change: I54V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: I54V

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159773
SMART Domains Protein: ENSMUSP00000125546
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 76 202 5.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160961
AA Change: I34V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: I34V

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162722
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Uxs1 T C 1: 43,827,623 Y29C probably damaging Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25151123 missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25151116 missense probably benign 0.13
IGL01912:Clcn7 APN 17 25153009 splice site probably benign
IGL01936:Clcn7 APN 17 25155376 missense probably benign 0.44
IGL02084:Clcn7 APN 17 25157925 missense probably benign
IGL02121:Clcn7 APN 17 25153084 missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25149030 unclassified probably benign
IGL02335:Clcn7 APN 17 25146847 missense probably benign 0.00
IGL02507:Clcn7 APN 17 25144469 missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25146818 missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25146453 unclassified probably benign
IGL03192:Clcn7 APN 17 25133601 missense probably benign 0.00
IGL03194:Clcn7 APN 17 25150548 missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25155385 missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25153754 missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25149202 unclassified probably benign
R0970:Clcn7 UTSW 17 25151234 critical splice donor site probably null
R1644:Clcn7 UTSW 17 25159698 missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25160471 missense probably damaging 1.00
R2173:Clcn7 UTSW 17 25145609 missense probably benign
R2401:Clcn7 UTSW 17 25153140 missense probably benign 0.02
R2511:Clcn7 UTSW 17 25155446 missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25159707 missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25160176 missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25157961 missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25153565 intron probably benign
R5372:Clcn7 UTSW 17 25157179 missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25149052 missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25157954 missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25151728 missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25157528 missense probably benign 0.01
R6798:Clcn7 UTSW 17 25159760 missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25157214 missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25146351 missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25153693 missense
X0020:Clcn7 UTSW 17 25150226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTTTCTCTCGTATGGAAC -3'
(R):5'- GTTCTAGGGACACCAGAATCTACC -3'

Sequencing Primer
(F):5'- CAGACAGGGTGGTGTACTGC -3'
(R):5'- CCCCAGGGTCAGAGGAAATG -3'
Posted On2014-10-01